AP2M1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
AP2M1 Polyclonal Antibody |
A53865 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
AP2M1 Polyclonal Antibody |
A54500 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
AP2M1 Polyclonal Antibody |
ABP57785-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180 |
AP2M1 Polyclonal Antibody |
ABP57785-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180 |
AP2M1 Polyclonal Antibody |
ABP57785-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
- Applications tips:
|
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180 |
AP2M1 Polyclonal Antibody |
ES8998-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against AP2M1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AP2M1 Polyclonal Antibody |
ES8998-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against AP2M1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
AP2M1 Rabbit mAb |
A11070-100ul |
Abclonal |
100 ul |
EUR 410 |
AP2M1 Rabbit mAb |
A11070-200ul |
Abclonal |
200 ul |
EUR 571 |
AP2M1 Rabbit mAb |
A11070-20ul |
Abclonal |
20 ul |
EUR 221 |
AP2M1 Rabbit mAb |
A11070-50ul |
Abclonal |
50 ul |
EUR 287 |
AP2M1 Rabbit pAb |
A13962-100ul |
Abclonal |
100 ul |
EUR 308 |
AP2M1 Rabbit pAb |
A13962-200ul |
Abclonal |
200 ul |
EUR 459 |
AP2M1 Rabbit pAb |
A13962-20ul |
Abclonal |
20 ul |
EUR 183 |
AP2M1 Rabbit pAb |
A13962-50ul |
Abclonal |
50 ul |
EUR 223 |
AP2M1 Rabbit pAb |
A2492-100ul |
Abclonal |
100 ul |
EUR 308 |
AP2M1 Rabbit pAb |
A2492-200ul |
Abclonal |
200 ul |
EUR 459 |
AP2M1 Rabbit pAb |
A2492-20ul |
Abclonal |
20 ul |
EUR 183 |
AP2M1 Rabbit pAb |
A2492-50ul |
Abclonal |
50 ul |
EUR 223 |
AP2M1 Polyclonal Antibody, HRP Conjugated |
A53866 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
AP2M1 Polyclonal Antibody, FITC Conjugated |
A53867 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
AP2M1 Polyclonal Antibody, Biotin Conjugated |
A53868 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
AP2M1 Polyclonal Antibody, HRP Conjugated |
A54501 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
AP2M1 Polyclonal Antibody, FITC Conjugated |
A54502 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
AP2M1 Polyclonal Antibody, Biotin Conjugated |
A54503 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit |
DLR-AP2m1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) in samples from tissue homogenates or other biological fluids. |
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit |
DLR-AP2m1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) in samples from tissue homogenates or other biological fluids. |
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit |
RDR-AP2m1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit |
RDR-AP2m1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit |
RD-AP2m1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit |
RD-AP2m1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
AP2M1 Antibody |
24892-100ul |
SAB |
100ul |
EUR 390 |
AP2M1 antibody |
70R-12583 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal AP2M1 antibody |
AP2M1 antibody |
70R-15215 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal AP2M1 antibody |
AP2M1 Antibody |
32670-100ul |
SAB |
100ul |
EUR 252 |
AP2M1 antibody |
10R-3324 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal AP2M1 antibody |
AP2M1 antibody |
10R-3326 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal AP2M1 antibody |
AP2M1 antibody |
10R-3327 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal AP2M1 antibody |
AP2M1 antibody |
10R-3331 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal AP2M1 antibody |
AP2M1 Antibody |
49143-100ul |
SAB |
100ul |
EUR 333 |
AP2M1 Antibody |
49143-50ul |
SAB |
50ul |
EUR 239 |
AP2M1 Antibody |
1-CSB-PA850274ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
AP2M1 Antibody |
1-CSB-PA00625A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
AP2M1 Antibody |
1-CSB-PA00627A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
AP2M1 Antibody |
DF6961 |
Affbiotech |
200ul |
EUR 304 |
Description: AP2M1 Antibody detects endogenous levels of total AP2M1. |
AP2M1 Antibody |
1-CSB-PA227771 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50 |
AP2M1 Antibody |
1-CSB-PA248529 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
AP2M1 antibody |
70R-36178 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit polyclonal AP2M1 antibody |
AP2M1 antibody |
70R-49558 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal AP2M1 antibody |
Phospho-AP2M1-T156 Rabbit pAb |
AP0823-100ul |
Abclonal |
100 ul |
EUR 384 |
Phospho-AP2M1-T156 Rabbit pAb |
AP0823-200ul |
Abclonal |
200 ul |
EUR 554 |
Phospho-AP2M1-T156 Rabbit pAb |
AP0823-20ul |
Abclonal |
20 ul |
EUR 183 |
Phospho-AP2M1-T156 Rabbit pAb |
AP0823-50ul |
Abclonal |
50 ul |
EUR 265 |
Anti-AP2M1 Antibody |
A06179 |
BosterBio |
100ug/vial |
EUR 294 |
AP2M1 antibody (HRP) |
60R-1485 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal AP2M1 antibody (HRP) |
AP2M1 antibody (FITC) |
60R-1486 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal AP2M1 antibody (FITC) |
AP2M1 antibody (biotin) |
60R-1487 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal AP2M1 antibody (biotin) |
AP2M1 Conjugated Antibody |
C49143 |
SAB |
100ul |
EUR 397 |
AP2M1 Conjugated Antibody |
C32670 |
SAB |
100ul |
EUR 397 |
Anti-AP2M1 antibody |
STJ115897 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene. |
Anti-AP2M1 antibody |
STJ22628 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene. |
Anti-AP2M1 antibody |
STJ190156 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to AP2M1 |
AP2M1 siRNA |
20-abx900351 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AP2M1 siRNA |
20-abx907722 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AP2M1 siRNA |
20-abx907723 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AP2M1 Antibody, HRP conjugated |
1-CSB-PA00625B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
AP2M1 Antibody, FITC conjugated |
1-CSB-PA00625C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
AP2M1 Antibody, Biotin conjugated |
1-CSB-PA00625D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
AP2M1 Antibody, HRP conjugated |
1-CSB-PA00627B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
AP2M1 Antibody, FITC conjugated |
1-CSB-PA00627C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
AP2M1 Antibody, Biotin conjugated |
1-CSB-PA00627D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-AP2M1/Ap 2 Mu 1 Rabbit Monoclonal Antibody |
M06179 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal AP2M1/Ap 2 Mu 1 Antibody. Validated in WB and tested in Human, Mouse, Rat. |
AP2M1 Blocking Peptide |
DF6961-BP |
Affbiotech |
1mg |
EUR 195 |
AP2M1 Blocking Peptide |
20-abx062433 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
AP2M1 cloning plasmid |
CSB-CL850274HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1308
- Sequence: atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgtta
- Show more
|
Description: A cloning plasmid for the AP2M1 gene. |
AP2M1 cloning plasmid |
CSB-CL850274HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1302
- Sequence: atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgtta
- Show more
|
Description: A cloning plasmid for the AP2M1 gene. |
Anti-Phospho-AP2M1-(T156) antibody |
STJ117921 |
St John's Laboratory |
100 µl |
EUR 393 |
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene. |
Rat AP2M1 shRNA Plasmid |
20-abx987281 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse AP2M1 shRNA Plasmid |
20-abx969166 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human AP2M1 shRNA Plasmid |
20-abx950836 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
AP2M1 Recombinant Protein (Human) |
RP001444 |
ABM |
100 ug |
Ask for price |
AP2M1 Recombinant Protein (Human) |
RP001447 |
ABM |
100 ug |
Ask for price |
AP2M1 Recombinant Protein (Mouse) |
RP116252 |
ABM |
100 ug |
Ask for price |
AP2M1 Recombinant Protein (Rat) |
RP190430 |
ABM |
100 ug |
Ask for price |
Rabbit AP 2 complex subunit mu(AP2M1) ELISA kit |
E04A1073-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit AP 2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit AP 2 complex subunit mu(AP2M1) ELISA kit |
E04A1073-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit AP 2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit AP 2 complex subunit mu(AP2M1) ELISA kit |
E04A1073-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit AP 2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit AP-2 complex subunit mu(AP2M1) ELISA kit |
E04A1565-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit AP-2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
AP2M1 Rabbit Polyclonal Antibody