AP2M1 Rabbit Polyclonal Antibody

AP2M1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

AP2M1 Polyclonal Antibody
A53865 100 µg
EUR 570.55
Description: Ask the seller for details
AP2M1 Polyclonal Antibody
A54500 100 µg
EUR 570.55
Description: The best epigenetics products
AP2M1 Polyclonal Antibody
ABP57785-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
AP2M1 Polyclonal Antibody
ABP57785-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
AP2M1 Polyclonal Antibody
ABP57785-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of AP2M1 from Human, Mouse, Rat. This AP2M1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AP2M1 protein at amino acid sequence of 100-180
AP2M1 Polyclonal Antibody
ES8998-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AP2M1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
AP2M1 Polyclonal Antibody
ES8998-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AP2M1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
AP2M1 Rabbit mAb
A11070-100ul 100 ul
EUR 410
AP2M1 Rabbit mAb
A11070-200ul 200 ul
EUR 571
AP2M1 Rabbit mAb
A11070-20ul 20 ul
EUR 221
AP2M1 Rabbit mAb
A11070-50ul 50 ul
EUR 287
AP2M1 Rabbit pAb
A13962-100ul 100 ul
EUR 308
AP2M1 Rabbit pAb
A13962-200ul 200 ul
EUR 459
AP2M1 Rabbit pAb
A13962-20ul 20 ul
EUR 183
AP2M1 Rabbit pAb
A13962-50ul 50 ul
EUR 223
AP2M1 Rabbit pAb
A2492-100ul 100 ul
EUR 308
AP2M1 Rabbit pAb
A2492-200ul 200 ul
EUR 459
AP2M1 Rabbit pAb
A2492-20ul 20 ul
EUR 183
AP2M1 Rabbit pAb
A2492-50ul 50 ul
EUR 223
AP2M1 Polyclonal Antibody, HRP Conjugated
A53866 100 µg
EUR 570.55
Description: The best epigenetics products
AP2M1 Polyclonal Antibody, FITC Conjugated
A53867 100 µg
EUR 570.55
Description: kits suitable for this type of research
AP2M1 Polyclonal Antibody, Biotin Conjugated
A53868 100 µg
EUR 570.55
Description: fast delivery possible
AP2M1 Polyclonal Antibody, HRP Conjugated
A54501 100 µg
EUR 570.55
Description: kits suitable for this type of research
AP2M1 Polyclonal Antibody, FITC Conjugated
A54502 100 µg
EUR 570.55
Description: fast delivery possible
AP2M1 Polyclonal Antibody, Biotin Conjugated
A54503 100 µg
EUR 570.55
Description: reagents widely cited
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit
DLR-AP2m1-Hu-48T 48T
EUR 517
  • Should the Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) in samples from tissue homogenates or other biological fluids.
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit
DLR-AP2m1-Hu-96T 96T
EUR 673
  • Should the Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) in samples from tissue homogenates or other biological fluids.
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit
RDR-AP2m1-Hu-48Tests 48 Tests
EUR 544
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit
RDR-AP2m1-Hu-96Tests 96 Tests
EUR 756
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit
RD-AP2m1-Hu-48Tests 48 Tests
EUR 521
Human Adaptor Related Protein Complex 2 Mu 1 (AP2m1) ELISA Kit
RD-AP2m1-Hu-96Tests 96 Tests
EUR 723
AP2M1 Antibody
24892-100ul 100ul
EUR 390
AP2M1 antibody
70R-12583 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal AP2M1 antibody
AP2M1 antibody
70R-15215 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody
AP2M1 Antibody
32670-100ul 100ul
EUR 252
AP2M1 antibody
10R-3324 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody
AP2M1 antibody
10R-3326 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody
AP2M1 antibody
10R-3327 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody
AP2M1 antibody
10R-3331 100 ul
EUR 691
Description: Mouse monoclonal AP2M1 antibody
AP2M1 Antibody
49143-100ul 100ul
EUR 333
AP2M1 Antibody
49143-50ul 50ul
EUR 239
AP2M1 Antibody
1-CSB-PA850274ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
AP2M1 Antibody
1-CSB-PA00625A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
AP2M1 Antibody
1-CSB-PA00627A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
AP2M1 Antibody
DF6961 200ul
EUR 304
Description: AP2M1 Antibody detects endogenous levels of total AP2M1.
AP2M1 Antibody
1-CSB-PA227771
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50
AP2M1 Antibody
1-CSB-PA248529
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
AP2M1 antibody
70R-36178 100 ug
EUR 349
Description: Rabbit polyclonal AP2M1 antibody
AP2M1 antibody
70R-49558 100 ul
EUR 244
Description: Purified Polyclonal AP2M1 antibody
AP2M1 Antibody
ABD6961 100 ug
EUR 438
Phospho-AP2M1-T156 Rabbit pAb
AP0823-100ul 100 ul
EUR 384
Phospho-AP2M1-T156 Rabbit pAb
AP0823-200ul 200 ul
EUR 554
Phospho-AP2M1-T156 Rabbit pAb
AP0823-20ul 20 ul
EUR 183
Phospho-AP2M1-T156 Rabbit pAb
AP0823-50ul 50 ul
EUR 265
Anti-AP2M1 Antibody
A06179 100ug/vial
EUR 294
AP2M1 antibody (HRP)
60R-1485 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody (HRP)
AP2M1 antibody (FITC)
60R-1486 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody (FITC)
AP2M1 antibody (biotin)
60R-1487 100 ug
EUR 327
Description: Rabbit polyclonal AP2M1 antibody (biotin)
AP2M1 Conjugated Antibody
C49143 100ul
EUR 397
AP2M1 Conjugated Antibody
C32670 100ul
EUR 397
Anti-AP2M1 antibody
STJ115897 100 µl
EUR 277
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.
Anti-AP2M1 antibody
STJ22628 100 µl
EUR 277
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.
Anti-AP2M1 antibody
STJ190156 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to AP2M1
Rabbit Anti-AP2M1 monoclonal antibody, clone TE0857
DCABH-9663 100 ul
EUR 777
Ap2m1/ Rat Ap2m1 ELISA Kit
ELI-24339r 96 Tests
EUR 886
AP2M1 siRNA
20-abx900351
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AP2M1 siRNA
20-abx907722
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AP2M1 siRNA
20-abx907723
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
AP2M1 Antibody, HRP conjugated
1-CSB-PA00625B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
AP2M1 Antibody, FITC conjugated
1-CSB-PA00625C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
AP2M1 Antibody, Biotin conjugated
1-CSB-PA00625D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
AP2M1 Antibody, HRP conjugated
1-CSB-PA00627B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
AP2M1 Antibody, FITC conjugated
1-CSB-PA00627C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
AP2M1 Antibody, Biotin conjugated
1-CSB-PA00627D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AP2M1. Recognizes AP2M1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-AP2M1/Ap 2 Mu 1 Rabbit Monoclonal Antibody
M06179 100ug/vial
EUR 397
Description: Rabbit Monoclonal AP2M1/Ap 2 Mu 1 Antibody. Validated in WB and tested in Human, Mouse, Rat.
AP2M1 Blocking Peptide
DF6961-BP 1mg
EUR 195
AP2M1 Blocking Peptide
20-abx062433
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
AP2M1 cloning plasmid
CSB-CL850274HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1308
  • Sequence: atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgtta
  • Show more
Description: A cloning plasmid for the AP2M1 gene.
AP2M1 cloning plasmid
CSB-CL850274HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1302
  • Sequence: atgattggaggcttattcatctataatcacaagggggaggtgctcatctcccgagtctaccgagatgacatcgggaggaacgcagtggatgcctttcgggtcaatgttatccatgcccggcagcaggtgcgcagccccgtcaccaacattgctcgcaccagcttcttccacgtta
  • Show more
Description: A cloning plasmid for the AP2M1 gene.
pDONR223-AP2M1 Plasmid
PVTB01145-1 2 ug
EUR 356
pENTR223-AP2M1 vector
PVT12121 2 ug
EUR 308
Anti-Phospho-AP2M1-(T156) antibody
STJ117921 100 µl
EUR 393
Description: This gene encodes a subunit of the heterotetrameric coat assembly protein complex 2 (AP2), which belongs to the adaptor complexes medium subunits family. The encoded protein is required for the activity of a vacuolar ATPase, which is responsible for proton pumping occurring in the acidification of endosomes and lysosomes. The encoded protein may also play an important role in regulating the intracellular trafficking and function of CTLA-4 protein. Three transcript variants encoding different isoforms have been found for this gene.
Rat AP2M1 shRNA Plasmid
20-abx987281
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse AP2M1 shRNA Plasmid
20-abx969166
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human AP2M1 shRNA Plasmid
20-abx950836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pECMV-3-FLAG-AP2M1
PVT12642 2 ug
EUR 703
AP2M1 Recombinant Protein (Human)
RP001444 100 ug Ask for price
AP2M1 Recombinant Protein (Human)
RP001447 100 ug Ask for price
AP2M1 Recombinant Protein (Mouse)
RP116252 100 ug Ask for price
AP2M1 Recombinant Protein (Rat)
RP190430 100 ug Ask for price
Rabbit AP 2 complex subunit mu(AP2M1) ELISA kit
E04A1073-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit AP 2 complex subunit mu(AP2M1) ELISA kit
E04A1073-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit AP 2 complex subunit mu(AP2M1) ELISA kit
E04A1073-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit AP 2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit AP-2 complex subunit mu(AP2M1) ELISA kit
E04A1565-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit AP-2 complex subunit mu(AP2M1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

AP2M1 Rabbit Polyclonal Antibody

Back To Top