ASAP2 Rabbit Polyclonal Antibody

ASAP2 Rabbit Polyclonal Antibody

To Order:

ASAP2 Polyclonal Antibody

ABP57822-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human ASAP2 protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of ASAP2 from Human, Mouse. This ASAP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ASAP2 protein at amino acid sequence of 640-720

ASAP2 Polyclonal Antibody

ABP57822-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human ASAP2 protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of ASAP2 from Human, Mouse. This ASAP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ASAP2 protein at amino acid sequence of 640-720

ASAP2 Polyclonal Antibody

ABP57822-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human ASAP2 protein at amino acid sequence of 640-720
  • Applications tips:
Description: A polyclonal antibody for detection of ASAP2 from Human, Mouse. This ASAP2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ASAP2 protein at amino acid sequence of 640-720

ASAP2 Rabbit pAb

A17579-100ul 100 ul
EUR 308

ASAP2 Rabbit pAb

A17579-200ul 200 ul
EUR 459

ASAP2 Rabbit pAb

A17579-20ul 20 ul
EUR 183

ASAP2 Rabbit pAb

A17579-50ul 50 ul
EUR 223

ASAP2 Antibody

ABD9441 100 ug
EUR 438

ASAP2 Antibody

45922-100ul 100ul
EUR 252

ASAP2 Antibody

45922-50ul 50ul
EUR 187

ASAP2 Antibody

DF9441 200ul
EUR 304
Description: ASAP2 Antibody detects endogenous levels of total ASAP2.

ASAP2 Conjugated Antibody

C45922 100ul
EUR 397

Anti-ASAP2 antibody

STJ119651 100 µl
EUR 277
Description: This gene encodes a multidomain protein containing an N-terminal alpha-helical region with a coiled-coil motif, followed by a pleckstrin homology (PH) domain, an Arf-GAP domain, an ankyrin homology region, a proline-rich region, and a C-terminal Src homology 3 (SH3) domain. The protein localizes in the Golgi apparatus and at the plasma membrane, where it colocalizes with protein tyrosine kinase 2-beta (PYK2). The encoded protein forms a stable complex with PYK2 in vivo. This interaction appears to be mediated by binding of its SH3 domain to the C-terminal proline-rich domain of PYK2. The encoded protein is tyrosine phosphorylated by activated PYK2. It has catalytic activity for class I and II ArfGAPs in vitro, and can bind the class III Arf ARF6 without immediate GAP activity. The encoded protein is believed to function as an ARF GAP that controls ARF-mediated vesicle budding when recruited to Golgi membranes. In addition, it functions as a substrate and downstream target for PYK2 and SRC, a pathway that may be involved in the regulation of vesicular transport. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]

Anti-ASAP2 antibody

STJ190149 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to ASAP2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-ASAP2/Pag3 Antibody

A09026 100 ug
EUR 397
Description: Rabbit Polyclonal ASAP2/Pag3 Antibody. Validated in WB and tested in Human.

ASAP2 Blocking Peptide

DF9441-BP 1mg
EUR 195

ASAP2 cloning plasmid

CSB-CL002176HU-10ug 10ug
EUR 917
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2886
  • Sequence: atgccggaccagatctccgtgtcggaattcgtggccgagacccatgaggactacaaggcgcccacggcctccagcttcaccacccgcacggcgcagtgccggaacactgtggcggccatcgaggaggctttggacgtggaccggatggttctttacaaaatgaagaaatccgtga
  • Show more
Description: A cloning plasmid for the ASAP2 gene.

Mouse ASAP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Asap2 ELISA KIT

ELI-11330m 96 Tests
EUR 865


ELI-34288h 96 Tests
EUR 824

Human ASAP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASAP2 ORF Vector (Human) (pORF)

ORF000670 1.0 ug DNA
EUR 95

Asap2 ORF Vector (Mouse) (pORF)

ORF039140 1.0 ug DNA
EUR 506

Asap2 ORF Vector (Mouse) (pORF)

ORF039141 1.0 ug DNA
EUR 506

Asap2 ORF Vector (Mouse) (pORF)

ORF039142 1.0 ug DNA
EUR 506

ASAP2 sgRNA CRISPR Lentivector set (Human)

K0130901 3 x 1.0 ug
EUR 339

Asap2 sgRNA CRISPR Lentivector set (Mouse)

K4051601 3 x 1.0 ug
EUR 339

ASAP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0130902 1.0 ug DNA
EUR 154

ASAP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0130903 1.0 ug DNA
EUR 154

ASAP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0130904 1.0 ug DNA
EUR 154

Asap2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4051602 1.0 ug DNA
EUR 154

Asap2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4051603 1.0 ug DNA
EUR 154

Asap2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4051604 1.0 ug DNA
EUR 154

ASAP2 Protein Vector (Human) (pPB-C-His)

PV002677 500 ng
EUR 329

ASAP2 Protein Vector (Human) (pPB-N-His)

PV002678 500 ng
EUR 329

ASAP2 Protein Vector (Human) (pPM-C-HA)

PV002679 500 ng
EUR 329

ASAP2 Protein Vector (Human) (pPM-C-His)

PV002680 500 ng
EUR 329

ASAP2 Protein Vector (Human) (pPB-His-MBP)

PV324158 500 ng
EUR 329

ASAP2 Protein Vector (Human) (pPB-His-GST)

PV324159 500 ng
EUR 329

ASAP2 Protein Vector (Mouse) (pPB-C-His)

PV156558 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPB-N-His)

PV156559 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPM-C-HA)

PV156560 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPM-C-His)

PV156561 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPB-C-His)

PV156562 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPB-N-His)

PV156563 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPM-C-HA)

PV156564 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPM-C-His)

PV156565 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPB-C-His)

PV156566 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPB-N-His)

PV156567 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPM-C-HA)

PV156568 500 ng
EUR 1065

ASAP2 Protein Vector (Mouse) (pPM-C-His)

PV156569 500 ng
EUR 1065

Asap2 3'UTR Luciferase Stable Cell Line

TU200953 1.0 ml Ask for price

Asap2 3'UTR GFP Stable Cell Line

TU152185 1.0 ml Ask for price

ASAP2 3'UTR Luciferase Stable Cell Line

TU001225 1.0 ml
EUR 1521

Asap2 3'UTR Luciferase Stable Cell Line

TU102185 1.0 ml Ask for price

ASAP2 3'UTR GFP Stable Cell Line

TU051225 1.0 ml
EUR 1521

Asap2 3'UTR GFP Stable Cell Line

TU250953 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

ASAP2 Rabbit Polyclonal Antibody

Back To Top