AVP Receptor V2 Rabbit Polyclonal Antibody

AVP Receptor V2 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

AVP Receptor V2 Polyclonal Antibody
ABP57859-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V2 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human, Mouse. This AVP Receptor V2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V2 protein at amino acid sequence of 1-50

AVP Receptor V2 Polyclonal Antibody
ABP55727-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human. This AVP Receptor V2 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120

AVP Receptor V2 Polyclonal Antibody
ABP55727-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human. This AVP Receptor V2 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120

AVP Receptor V2 Polyclonal Antibody
ABP55727-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V2 from Human. This AVP Receptor V2 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V2 at AA range: 40-120

AVP Receptor V2 Polyclonal Antibody
ES8846-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AVP Receptor V2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AVP Receptor V2 Polyclonal Antibody
ES8846-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AVP Receptor V2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

AVP Receptor V2 Polyclonal Antibody
ES6726-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AVP Receptor V2 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

AVP Receptor V2 Polyclonal Antibody
ES6726-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AVP Receptor V2 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

AVP Receptor V2 Polyclonal Conjugated Antibody
C46898 100ul
EUR 397

Anti-AVP Receptor V2 antibody
STJ91788 200 µl
EUR 197
Description: Rabbit polyclonal to AVP Receptor V2.

Anti-AVP Receptor V2 antibody
STJ99319 200 µl
EUR 197
Description: Rabbit polyclonal to AVP Receptor V2.

Rabbit Anti-Rat AVP-V2 Antiserum
AVPV21-S 100 ul
EUR 457

Rabbit Anti-Rat AVP-V2 IgG, aff pure
AVPV21-A 100 ug
EUR 482

cfPure® MAX V2 Cell-Free DNA Extraction Kit
K5011625MA-V2 1 kit
EUR 498

Rat AVP-V2 Control/blocking peptide
AVPV21-P 100 ug
EUR 164

cfPure® V2 Cell Free DNA Extraction Kit, 100 ml
K5011610-V2 1 kit
EUR 448

cfPure® V2 Cell Free DNA Extraction Kit, 250 ml
K5011625-V2 1 kit
EUR 748

Polyclonal Vasopressin V2 Receptor Antibody
APR13942G 0.05ml
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Vasopressin V2 Receptor . This antibody is tested and proven to work in the following applications:

AVP Receptor V3 Polyclonal Antibody
46878-100ul 100ul
EUR 252

AVP Receptor V3 Polyclonal Antibody
46878-50ul 50ul
EUR 187

AVP Receptor V3 Polyclonal Antibody
ABP50738-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human. This AVP Receptor V3 antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330

AVP Receptor V3 Polyclonal Antibody
ABP50738-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human. This AVP Receptor V3 antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330

AVP Receptor V3 Polyclonal Antibody
ABP50738-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human. This AVP Receptor V3 antibody is for WB , IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human AVP Receptor V3 at AA range: 250-330

AVP Receptor V3 Polyclonal Antibody
ABP57860-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human, Mouse, Rat. This AVP Receptor V3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320

AVP Receptor V3 Polyclonal Antibody
ABP57860-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human, Mouse, Rat. This AVP Receptor V3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320

AVP Receptor V3 Polyclonal Antibody
ABP57860-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320
  • Applications tips:
Description: A polyclonal antibody for detection of AVP Receptor V3 from Human, Mouse, Rat. This AVP Receptor V3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human AVP Receptor V3 protein at amino acid sequence of 271-320

AVP Receptor V3 Polyclonal Antibody
ES8759-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AVP Receptor V3 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

AVP Receptor V3 Polyclonal Antibody
ES8759-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AVP Receptor V3 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

AVP Receptor V3 Polyclonal Antibody
ES1737-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against AVP Receptor V3 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

AVP Receptor V3 Polyclonal Antibody
ES1737-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against AVP Receptor V3 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Vasopressin V2 Receptor Antibody
20-abx133128
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

AVP Receptor V3 Polyclonal Conjugated Antibody
C46878 100ul
EUR 397

AVP Polyclonal Antibody
A54862 100 µg
EUR 570.55
Description: fast delivery possible

Anti-Vasopressin Receptor V2 Antibody
A01660 100ug
EUR 420
Description: Rabbit Polyclonal antibody for Avpr2 detection. Tested positive for ELISA, IHC, WB in Human, Mouse, Rat

AVP Rabbit pAb
A1725-100ul 100 ul
EUR 308

AVP Rabbit pAb
A1725-200ul 200 ul
EUR 459

AVP Rabbit pAb
A1725-20ul 20 ul
EUR 183

AVP Rabbit pAb
A1725-50ul 50 ul
EUR 223

Polyclonal AVP Antibody (Center)
APG03184G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human AVP (Center). This antibody is tested and proven to work in the following applications:

Anti-AVP Receptor V3 antibody
STJ91789 200 µl
EUR 197
Description: Rabbit polyclonal to AVP Receptor V3.

Anti-AVP Receptor V3 antibody
STJ98822 200 µl
EUR 197
Description: Rabbit polyclonal to AVP Receptor V3.

Pig Vasopressin V2 receptor (AVPR2)
1-CSB-EP002470PI
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 24.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Pig Vasopressin V2 receptor(AVPR2),partial expressed in E.coli

Vasopressin V2 Receptor Blocking Peptide
20-abx161789
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Rabbit AVP ELISA Kit
ERTA0909 96Tests
EUR 521

AVP Polyclonal Antibody, Biotin Conjugated
A57843 100 µg
EUR 570.55
Description: fast delivery possible

AVP Polyclonal Antibody, FITC Conjugated
A57844 100 µg
EUR 570.55
Description: reagents widely cited

AVP Polyclonal Antibody, HRP Conjugated
A54861 100 µg
EUR 570.55
Description: reagents widely cited

AVP Antibody
47965-100ul 100ul
EUR 252

AVP Antibody
1-CSB-PA11069A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AVP. Recognizes AVP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

BenchMixer V2
BV1003-E 1 PC
EUR 284.31
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.
Description: Vornado Vortex Mixer is powerful vortexing for tubes up to 50ml. Has the following main advantages: Inst-Touch pressure activated operation"Mini Sized", less than 4 in. wide, vailable in five color configurations

pNI- v2
PVT10897 2 ug
EUR 301

pNG- v2
PVT10898 2 ug
EUR 301

pNN- v2
PVT10899 2 ug
EUR 301

pHD- v2
PVT10900 2 ug
EUR 301

pLentiCRISPR V2
PVT10913 2 ug
EUR 301

lentiMPH v2
PVT10984 2 ug
EUR 266

AVP Conjugated Antibody
C47965 100ul
EUR 397

Anti-AVP antibody
STJ117784 100 µl
EUR 277
Description: This gene encodes a member of the vasopressin/oxytocin family and preproprotein that is proteolytically processed to generate multiple protein products. These products include the neuropeptide hormone arginine vasopressin, and two other peptides, neurophysin 2 and copeptin. Arginine vasopressin is a posterior pituitary hormone that is synthesized in the supraoptic nucleus and paraventricular nucleus of the hypothalamus. Along with its carrier protein, neurophysin 2, it is packaged into neurosecretory vesicles and transported axonally to the nerve endings in the neurohypophysis where it is either stored or secreted into the bloodstream. The precursor is thought to be activated while it is being transported along the axon to the posterior pituitary. Arginine vasopressin acts as a growth factor by enhancing pH regulation through acid-base transport systems. It has a direct antidiuretic action on the kidney, and also causes vasoconstriction of the peripheral vessels. This hormone can contract smooth muscle during parturition and lactation. It is also involved in cognition, tolerance, adaptation and complex sexual and maternal behaviour, as well as in the regulation of water excretion and cardiovascular functions. Mutations in this gene cause autosomal dominant neurohypophyseal diabetes insipidus (ADNDI). This gene is present in a gene cluster with the related gene oxytocin on chromosome 20.

Anti-AVP antibody
STJ400041 1 mg
EUR 446
Description: Copeptin is a 39-amino acid glycopeptide, cleaved from the C-terminus of pre- provasopressin (pre-proAVP). It has been suggested as a biomarker in diagnosis and prognosis of several diseases, such as acute myocardial infarction, heart failure, hyponatremia, and sepsis.

Anti-AVP antibody
STJ400042 1 mg
EUR 446
Description: Copeptin is a 39-amino acid glycopeptide, cleaved from the C-terminus of pre- provasopressin (pre-proAVP). It has been suggested as a biomarker in diagnosis and prognosis of several diseases, such as acute myocardial infarction, heart failure, hyponatremia, and sepsis.

Anti-AVP antibody
STJ400043 1 mg
EUR 446
Description: Copeptin is a 39-amino acid glycopeptide, cleaved from the C-terminus of pre- provasopressin (pre-proAVP). It has been suggested as a biomarker in diagnosis and prognosis of several diseases, such as acute myocardial infarction, heart failure, hyponatremia, and sepsis.

Anti-AVP antibody
STJ400044 1 mg
EUR 446
Description: Copeptin is a 39-amino acid glycopeptide, cleaved from the C-terminus of pre- provasopressin (pre-proAVP). It has been suggested as a biomarker in diagnosis and prognosis of several diseases, such as acute myocardial infarction, heart failure, hyponatremia, and sepsis.

Bovine Vasopressin V2 receptor, AVPR2 ELISA KIT
ELI-16753b 96 Tests
EUR 928

Human Vasopressin V2 receptor, AVPR2 ELISA KIT
ELI-17463h 96 Tests
EUR 824

Porcine Vasopressin V2 receptor, AVPR2 ELISA KIT
ELI-39834p 96 Tests
EUR 928

Mouse Vasopressin V2 receptor, Avpr2 ELISA KIT
ELI-40647m 96 Tests
EUR 865

IWP-2-V2
C3625-10 10 mg
EUR 425
Description: IC50: 27 nMIWP-2-V2 is a Wnt production inhibitor.Wnt signaling proteins are small secreted proteins that are active in tissue homeostasis, embryonic development, and tumorigenesis.

IWP-2-V2
C3625-25 25 mg
EUR 833
Description: IC50: 27 nMIWP-2-V2 is a Wnt production inhibitor.Wnt signaling proteins are small secreted proteins that are active in tissue homeostasis, embryonic development, and tumorigenesis.

IWP-2-V2
C3625-5 5 mg
EUR 248
Description: IC50: 27 nMIWP-2-V2 is a Wnt production inhibitor.Wnt signaling proteins are small secreted proteins that are active in tissue homeostasis, embryonic development, and tumorigenesis.

pTALEN- V2 NG
PVT10906 2 ug
EUR 301

pTALEN- V2 NN
PVT10907 2 ug
EUR 301

lentiSAM v2 (Puro)
PVT14644 2 ug
EUR 703

Rabbit Anti-Rat AVP V1b Antiserum
AVP1B13-S 100 ul
EUR 457

Rabbit Arginine vasopressin, AVP ELISA Kit
CELI-66041Rb 96 Tests
EUR 928

Rabbit arginine vasopressin (AVP) ELISA kit
CSB-EL002466RB-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit arginine vasopressin (AVP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rabbit arginine vasopressin (AVP) ELISA kit
1-CSB-EL002466RB
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rabbit arginine vasopressin (AVP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rabbit ADH/VP/AVP ELISA Kit
ERTA0745 96Tests
EUR 521

AVP siRNA
20-abx900562
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AVP siRNA
20-abx908728
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AVP siRNA
20-abx908729
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

AVP Antibody, HRP conjugated
1-CSB-PA11069B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AVP. Recognizes AVP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AVP Antibody, FITC conjugated
1-CSB-PA11069C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AVP. Recognizes AVP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AVP Antibody, Biotin conjugated
1-CSB-PA11069D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AVP. Recognizes AVP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Arginine Vasopressin (AVP) Antibody
abx411676-50ul 50 ul
EUR 439
  • Shipped within 1 week.

Arginine Vasopressin (AVP) Antibody
abx412424-01ml 0.1 ml
EUR 578
  • Shipped within 1 week.

Rabbit Anti-Rat AVP V1a Antiserum #1
AVP1A11-S 100 ul
EUR 457

Rabbit Anti-Rat AVP V1a Antiserum #2
AVP1A12-S 100 ul
EUR 457

CMV-Null control Adenovirus
AVP-Null 1x109 IFU/ml x 200ul
EUR 349
Description: Pre-made Null-control Adenovirus , provided in DMEM medium.

Human AVP Protein
30-1960 50 ug
EUR 259
Description: Recombinant Human Vasopressin-neurophysin 2-copeptin(AVP)

d[Cha4]-AVP
B5382-1 1 mg
EUR 535

AVP cloning plasmid
CSB-CL002466HU-10ug 10ug
EUR 248
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 495
  • Sequence: atgcctgacaccatgctgcccgcctgcttcctcggcctactggccttctcctccgcgtgctacttccagaactgcccgaggggcggcaagagggccatgtccgacctggagctgagacagtgcctcccctgcggccccgggggcaaaggccgctgcttcgggcccagcatctgctg
  • Show more
Description: A cloning plasmid for the AVP gene.

Glucocorticoid receptor/GR Rabbit Polyclonal Antibody
38045-100ul 100ul
EUR 252

Glucocorticoid receptor/GR Rabbit Polyclonal Antibody
38045-50ul 50ul
EUR 187

GenomeCoV19 Detection Kit
G628.v2 100 Rxns
EUR 320
Description: The most affordable qPCR Detection Kit for SARS-CoV-2 on the market.abm’s GenomeCoV19 Detection Kit is a real-time reverse transcription-polymerase chain reaction (RT-qPCR) test intended for the qualitative detection of RNA from SARS-CoV-2 in human nasopharyngeal and oropharyngeal swab specimens from individuals suspected of COVID-19 by their healthcare provider. Our GenomeCoV19 Detection Kit is the most affordable qPCR detection kit on the market at only $1.77 USD/test (limited time pricing for US customers only).This kit is widely used in Europe under the CE-IVD certification and is listed by U.S. Food and Drug Administration (FDA) for distribution in the USA, under Section IV.C.

Rabbit Anti-Rat AVP V1b IgG, aff pure
AVP1B13-A 100 ug
EUR 482

Recombinant Pig Vasopressin V2 receptor Protein, His-SUMO, E.coli-100ug
QP5701-ec-100ug 100ug
EUR 707

Recombinant Pig Vasopressin V2 receptor Protein, His-SUMO, E.coli-10ug
QP5701-ec-10ug 10ug
EUR 326

Recombinant Pig Vasopressin V2 receptor Protein, His-SUMO, E.coli-1mg
QP5701-ec-1mg 1mg
EUR 2303

Recombinant Pig Vasopressin V2 receptor Protein, His-SUMO, E.coli-200ug
QP5701-ec-200ug 200ug
EUR 1115

Recombinant Pig Vasopressin V2 receptor Protein, His-SUMO, E.coli-500ug
QP5701-ec-500ug 500ug
EUR 1514

Recombinant Pig Vasopressin V2 receptor Protein, His-SUMO, E.coli-50ug
QP5701-ec-50ug 50ug
EUR 435

Ubiquitin Conjugating Enzyme E2 V2 (UBE2V2) Antibody
20-abx007169
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 V2 (UBE2V2) Antibody
abx038332-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 V2 (UBE2V2) Antibody
abx029357-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 V2 (UBE2V2) Antibody
abx029357-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 V2 (UBE2V2) Antibody
20-abx338807
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ubiquitin Conjugating Enzyme E2 V2 (UBE2V2) Antibody
20-abx322316
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Blood Direct PCR Kit V2
PD103-01 50 rxn
EUR 169

Blood Direct PCR Kit V2
PD103-02 200 rxn
EUR 354

pE2F(V2)-TA-luc Plasmid
PVTB00994-2b 2 ug
EUR 356

pp53(V2)-TA-luc Plasmid
PVTB00015-2f 2 ug
EUR 356

Vasopressin-Neurophysin 2-Copeptin (AVP) Antibody
20-abx110674
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat AVP ELISA kit
55R-1951 96 tests
EUR 617
Description: ELISA Kit for detection of AVP in the research laboratory

AVP Receptor V2 Rabbit Polyclonal Antibody

Back To Top