CBX8 Rabbit Polyclonal Antibody

CBX8 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

CBX8 Polyclonal Antibody
ABP58000-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CBX8 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of CBX8 from Human, Mouse. This CBX8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CBX8 protein at amino acid sequence of 140-220
CBX8 Polyclonal Antibody
ABP58000-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CBX8 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of CBX8 from Human, Mouse. This CBX8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CBX8 protein at amino acid sequence of 140-220
CBX8 Polyclonal Antibody
ABP58000-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CBX8 protein at amino acid sequence of 140-220
  • Applications tips:
Description: A polyclonal antibody for detection of CBX8 from Human, Mouse. This CBX8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CBX8 protein at amino acid sequence of 140-220
CBX8 Polyclonal Antibody
ES9094-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CBX8 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
CBX8 Polyclonal Antibody
ES9094-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CBX8 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
CBX8 Rabbit pAb
A6222-100ul 100 ul
EUR 308
CBX8 Rabbit pAb
A6222-200ul 200 ul
EUR 459
CBX8 Rabbit pAb
A6222-20ul 20 ul
EUR 183
CBX8 Rabbit pAb
A6222-50ul 50 ul
EUR 223
CBX8 Antibody
31048-100ul 100ul
EUR 252
CBX8 Antibody
31048-50ul 50ul
EUR 187
CBX8 antibody
38758-100ul 100ul
EUR 252
CBX8 Antibody
1-CSB-PA831688
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CBX8. Recognizes CBX8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:10-1:50
CBX8 Antibody
1-CSB-PA864026ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CBX8. Recognizes CBX8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200
CBX8 Antibody
DF8872 200ul
EUR 304
Description: CBX8 Antibody detects endogenous levels of total CBX8.
CBX8 Antibody
1-CSB-PA557525
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CBX8. Recognizes CBX8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:10-1:50
CBX8 Antibody
ABD8872 100 ug
EUR 438
CBX8 Conjugated Antibody
C31048 100ul
EUR 397
CBX8 Conjugated Antibody
C38758 100ul
EUR 397
Anti-CBX8 antibody
STJ27978 100 µl
EUR 277
Anti-CBX8 antibody
STJ71650 100 µg
EUR 359
Anti-CBX8 antibody
STJ190252 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CBX8
CBX8 siRNA
20-abx910439
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CBX8 siRNA
20-abx910440
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-Cbx8
YF-PA20169 50 ul
EUR 363
Description: Mouse polyclonal to Cbx8
Chromobox 8 (CBX8) Antibody
20-abx213105
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Chromobox 8 (CBX8) Antibody
20-abx213106
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
CBX6 and CBX8 Antibody
abx432458-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
CBX8 Blocking Peptide
DF8872-BP 1mg
EUR 195
CBX8 cloning plasmid
CSB-CL864026HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1170
  • Sequence: atggagctttcagcggtgggggagcgggtgttcgcggccgaagccctcctgaagcggcgcatacggaaaggacgcatggaatacctcgtgaaatggaagggatggtcgcagaagtacagcacatgggaaccggaggaaaacatcctggatgctcgcttgctcgcagcctttgagg
  • Show more
Description: A cloning plasmid for the CBX8 gene.
Rabbit Chromobox protein homolog 8(CBX8) ELISA kit
E04C1425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Chromobox protein homolog 8(CBX8) ELISA kit
E04C1425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Chromobox protein homolog 8(CBX8) ELISA kit
E04C1425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Chromobox Protein Homolog 8 (CBX8) Antibody
20-abx004753
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Chromobox Protein Homolog 8 (CBX8) Antibody
abx015789-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.
Chromobox Protein Homolog 8 (CBX8) Antibody
abx015790-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.
Chromobox Protein Homolog 8 (CBX8) Antibody
abx031612-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Chromobox Protein Homolog 8 (CBX8) Antibody
abx031612-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Chromobox Protein Homolog 8 (CBX8) Antibody
20-abx321435
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Chromobox Protein Homolog 8 (CBX8) Antibody
abx431904-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Chromobox Protein Homolog 8 (CBX8) Antibody
20-abx225076
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Chromobox Protein Homolog 8 (CBX8) Antibody
20-abx002058
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mouse CBX8 shRNA Plasmid
20-abx974062
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human CBX8 shRNA Plasmid
20-abx961414
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pcDNA6-Flag-CBX8 Plasmid
PVTB00739-2a 2 ug
EUR 356
CBX8 Recombinant Protein (Human)
RP005770 100 ug Ask for price
CBX8 Recombinant Protein (Rat)
RP193334 100 ug Ask for price
CBX8 Recombinant Protein (Mouse)
RP121469 100 ug Ask for price
Cbx8 ORF Vector (Rat) (pORF)
ORF064446 1.0 ug DNA
EUR 506
CBX8 ORF Vector (Human) (pORF)
ORF001924 1.0 ug DNA
EUR 95
Cbx8 ORF Vector (Mouse) (pORF)
ORF040491 1.0 ug DNA
EUR 506
CBX8 sgRNA CRISPR Lentivector set (Human)
K0371301 3 x 1.0 ug
EUR 339
Cbx8 sgRNA CRISPR Lentivector set (Rat)
K7154701 3 x 1.0 ug
EUR 339
Cbx8 sgRNA CRISPR Lentivector set (Mouse)
K4527701 3 x 1.0 ug
EUR 339
CBX8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0371302 1.0 ug DNA
EUR 154
CBX8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0371303 1.0 ug DNA
EUR 154
CBX8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0371304 1.0 ug DNA
EUR 154
Cbx8 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7154702 1.0 ug DNA
EUR 154
Cbx8 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7154703 1.0 ug DNA
EUR 154
Cbx8 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7154704 1.0 ug DNA
EUR 154
Cbx8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4527702 1.0 ug DNA
EUR 154
Cbx8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4527703 1.0 ug DNA
EUR 154
Cbx8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4527704 1.0 ug DNA
EUR 154
CBX8 3'UTR Luciferase Stable Cell Line
TU003570 1.0 ml
EUR 1521
Cbx8 3'UTR GFP Stable Cell Line
TU153206 1.0 ml Ask for price
Cbx8 3'UTR Luciferase Stable Cell Line
TU103206 1.0 ml Ask for price
Cbx8 3'UTR Luciferase Stable Cell Line
TU201727 1.0 ml Ask for price
Cbx8 3'UTR GFP Stable Cell Line
TU251727 1.0 ml Ask for price
CBX8 3'UTR GFP Stable Cell Line
TU053570 1.0 ml
EUR 1521
CBX8 Protein Vector (Mouse) (pPB-C-His)
PV161962 500 ng
EUR 603
CBX8 Protein Vector (Mouse) (pPB-N-His)
PV161963 500 ng
EUR 603
CBX8 Protein Vector (Mouse) (pPM-C-HA)
PV161964 500 ng
EUR 603
CBX8 Protein Vector (Mouse) (pPM-C-His)
PV161965 500 ng
EUR 603
CBX8 Protein Vector (Rat) (pPB-C-His)
PV257782 500 ng
EUR 603
CBX8 Protein Vector (Rat) (pPB-N-His)
PV257783 500 ng
EUR 603
CBX8 Protein Vector (Rat) (pPM-C-HA)
PV257784 500 ng
EUR 603
CBX8 Protein Vector (Rat) (pPM-C-His)
PV257785 500 ng
EUR 603
CBX8 Protein Vector (Human) (pPB-C-His)
PV007693 500 ng
EUR 329
CBX8 Protein Vector (Human) (pPB-N-His)
PV007694 500 ng
EUR 329
CBX8 Protein Vector (Human) (pPM-C-HA)
PV007695 500 ng
EUR 329
CBX8 Protein Vector (Human) (pPM-C-His)
PV007696 500 ng
EUR 329
Human Chromobox protein homolog 8, CBX8 ELISA KIT
ELI-10682h 96 Tests
EUR 824
Mouse Chromobox protein homolog 8, Cbx8 ELISA KIT
ELI-25534m 96 Tests
EUR 865
CBX8 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV654547 1.0 ug DNA
EUR 682
CBX8 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV654551 1.0 ug DNA
EUR 682
CBX8 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV654552 1.0 ug DNA
EUR 682
CBX8 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV791269 1.0 ug DNA
EUR 316
CBX8 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV791270 1.0 ug DNA
EUR 316
Human Chromobox protein homolog 8(CBX8) ELISA kit
E01C1425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Chromobox protein homolog 8(CBX8) ELISA kit
E01C1425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Chromobox protein homolog 8(CBX8) ELISA kit
E01C1425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Chromobox protein homolog 8(CBX8) ELISA kit
E02C1425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Chromobox protein homolog 8(CBX8) ELISA kit
E02C1425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Chromobox protein homolog 8(CBX8) ELISA kit
E02C1425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Chromobox protein homolog 8(CBX8) ELISA kit
E03C1425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Chromobox protein homolog 8(CBX8) ELISA kit
E03C1425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Chromobox protein homolog 8(CBX8) ELISA kit
E03C1425-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Chromobox protein homolog 8(CBX8) ELISA kit
E07C1425-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Chromobox protein homolog 8(CBX8) ELISA kit
E07C1425-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Chromobox protein homolog 8(CBX8) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CBX8 Rabbit Polyclonal Antibody

Back To Top