CD151 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
CD151 Polyclonal Antibody |
ABP58035-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140
- Applications tips:
|
Description: A polyclonal antibody for detection of CD151 from Human, Mouse, Rat. This CD151 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140 |
CD151 Polyclonal Antibody |
ABP58035-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140
- Applications tips:
|
Description: A polyclonal antibody for detection of CD151 from Human, Mouse, Rat. This CD151 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD151 protein at amino acid sequence of 91-140 |
CD151 Polyclonal Antibody |
46814-100ul |
SAB |
100ul |
EUR 252 |
CD151 Polyclonal Antibody |
46814-50ul |
SAB |
50ul |
EUR 187 |
CD151 Rabbit pAb |
A1930-100ul |
Abclonal |
100 ul |
EUR 308 |
CD151 Rabbit pAb |
A1930-200ul |
Abclonal |
200 ul |
EUR 459 |
CD151 Rabbit pAb |
A1930-20ul |
Abclonal |
20 ul |
EUR 183 |
CD151 Rabbit pAb |
A1930-50ul |
Abclonal |
50 ul |
EUR 223 |
CD151 Antigen (CD151) Antibody |
20-abx111462 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody |
abx122519-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody |
20-abx001576 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody |
20-abx326895 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody |
20-abx214915 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody |
20-abx318194 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody |
abx413443-02mg |
Abbexa |
0.2 mg |
EUR 565 |
|
CD151 Antigen (CD151) Antibody |
abx413446-01mg |
Abbexa |
0.1 mg |
EUR 439 |
|
CD151 Antigen (CD151) Antibody |
abx413449-25ug |
Abbexa |
25 ug |
EUR 272 |
|
CD151 Antigen (CD151) Antibody |
20-abx242412 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody |
20-abx225085 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody |
abx231431-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
CD151 Antigen (CD151) Antibody (HRP) |
20-abx314776 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody (FITC) |
20-abx314777 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody (Biotin) |
20-abx314778 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CD151 Antigen (CD151) Antibody (FITC) |
abx413444-01mg |
Abbexa |
0.1 mg |
EUR 509 |
|
CD151 Antigen (CD151) Antibody (FITC) |
abx413445-25ug |
Abbexa |
25 ug |
EUR 272 |
|
CD151 Antigen (CD151) Antibody (RPE) |
abx413447-100tests |
Abbexa |
100 tests |
EUR 592 |
|
CD151 Antigen (CD151) Antibody (RPE) |
abx413448-25tests |
Abbexa |
25 tests |
EUR 314 |
|
CD151 Antibody |
abx140514-01mg |
Abbexa |
0.1 mg |
EUR 356 |
- Shipped within 5-12 working days.
|
CD151 Antibody |
32504-100ul |
SAB |
100ul |
EUR 252 |
CD151 antibody |
70R-16255 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal CD151 antibody |
CD151 Antibody |
DF6699 |
Affbiotech |
200ul |
EUR 304 |
Description: CD151 Antibody detects endogenous levels of total CD151. |
CD151 Antibody |
1-CSB-PA940948 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200 |
CD151 Antibody |
1-CSB-PA004880GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
CD151 Antibody |
1-CSB-PA004880LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
CD151 Antibody |
1-CSB-PA151172 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:500-1:2000, IHC:1:10-1:50 |
CD151 Antibody |
1-CSB-PA153822 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000 |
Rabbit CD151 ELISA Kit |
ERTC0218 |
Abclonal |
96Tests |
EUR 521 |
anti- CD151 antibody |
FNab01431 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:200
- Immunogen: CD151 molecule (Raph blood group)
- Uniprot ID: P48509
- Gene ID: 977
- Research Area: Stem Cells, Immunology, Cardiovascular, Signal Transduction
|
Description: Antibody raised against CD151 |
anti- CD151 antibody |
FNab09920 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:2000-1:20000
- IHC: 1:200-1:1000
- Immunogen: CD151 molecule
- Uniprot ID: P48509
- Gene ID: 977
- Research Area: Stem Cells, Immunology, Cardiovascular, Signal Transduction
|
Description: Antibody raised against CD151 |
CD151 Antibody (PE) |
abx140520-100tests |
Abbexa |
100 tests |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-CD151 Antibody |
A02320-1 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-CD151 antibody |
STJ98746 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CD151. |
Anti-CD151 antibody |
STJ22974 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It is involved in cellular processes including cell adhesion and may regulate integrin trafficking and/or function. This protein enhances cell motility, invasion and metastasis of cancer cells. Multiple alternatively spliced transcript variants that encode the same protein have been described for this gene. |
Human CD151 Antigen (CD151) ELISA Kit |
abx386381-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse CD151 Antigen (CD151) ELISA Kit |
abx388802-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat CD151 Antigen (CD151) ELISA Kit |
abx391089-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
CD151 siRNA |
20-abx900896 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD151 siRNA |
20-abx910925 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD151 siRNA |
20-abx910926 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD151 Antibody, HRP conjugated |
1-CSB-PA004880LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CD151 Antibody, FITC conjugated |
1-CSB-PA004880LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CD151 Antibody, Biotin conjugated |
1-CSB-PA004880LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CD151. Recognizes CD151 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Cd151 ELISA Kit| Mouse CD151 antigen ELISA Kit |
EF014427 |
Lifescience Market |
96 Tests |
EUR 689 |
CD151 cloning plasmid |
CSB-CL004880HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 762
- Sequence: atgggtgagttcaacgagaagaagacaacatgtggcaccgtttgcctcaagtacctgctgtttacctacaattgctgcttctggctggctggcctggctgtcatggcagtgggcatctggacgctggccctcaagagtgactacatcagcctgctggcctcaggcacctacctggc
- Show more
|
Description: A cloning plasmid for the CD151 gene. |
CD151 Blocking Peptide |
DF6699-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-CD151 (1B2) |
YF-MA12355 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to CD151 |
Rat CD151 shRNA Plasmid |
20-abx986204 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CD151 ELISA Kit |
EHC0218 |
Abclonal |
96Tests |
EUR 521 |
Goat CD151 ELISA Kit |
EGTC0218 |
Abclonal |
96Tests |
EUR 521 |
Canine CD151 ELISA Kit |
ECC0218 |
Abclonal |
96Tests |
EUR 521 |
Chicken CD151 ELISA Kit |
ECKC0218 |
Abclonal |
96Tests |
EUR 521 |
Bovine CD151 ELISA Kit |
EBC0218 |
Abclonal |
96Tests |
EUR 521 |
Anserini CD151 ELISA Kit |
EAC0218 |
Abclonal |
96Tests |
EUR 521 |
Porcine CD151 ELISA Kit |
EPC0218 |
Abclonal |
96Tests |
EUR 521 |
Rat CD151 ELISA Kit |
ERC0218 |
Abclonal |
96Tests |
EUR 521 |
Sheep CD151 ELISA Kit |
ESC0218 |
Abclonal |
96Tests |
EUR 521 |
Mouse CD151 ELISA Kit |
EMC0218 |
Abclonal |
96Tests |
EUR 521 |
Monkey CD151 ELISA Kit |
EMKC0218 |
Abclonal |
96Tests |
EUR 521 |
Human CD151 shRNA Plasmid |
20-abx950698 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-Hu CD151 PE |
1P-149-T025 |
ExBio |
25 tests |
EUR 140 |
Anti-Hu CD151 PE |
1P-149-T100 |
ExBio |
100 tests |
EUR 240 |
Anti-Hu CD151 Purified |
11-149-C025 |
ExBio |
0.025 mg |
EUR 99 |
Anti-Hu CD151 Purified |
11-149-C100 |
ExBio |
0.1 mg |
EUR 158 |
Mouse CD151 shRNA Plasmid |
20-abx969545 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CD151 Recombinant Protein (Human) |
RP006271 |
ABM |
100 ug |
Ask for price |
CD151 Recombinant Protein (Rat) |
RP193841 |
ABM |
100 ug |
Ask for price |
CD151 Recombinant Protein (Mouse) |
RP122345 |
ABM |
100 ug |
Ask for price |
CD151 Recombinant Protein (Mouse) |
RP122348 |
ABM |
100 ug |
Ask for price |
CD151 Recombinant Protein (Mouse) |
RP122351 |
ABM |
100 ug |
Ask for price |
Guinea Pig CD151 ELISA Kit |
EGC0218 |
Abclonal |
96Tests |
EUR 521 |
CD151 ORF Vector (Human) (pORF) |
ORF002091 |
ABM |
1.0 ug DNA |
EUR 95 |
Cd151 ORF Vector (Mouse) (pORF) |
ORF040783 |
ABM |
1.0 ug DNA |
EUR 506 |
Cd151 ORF Vector (Mouse) (pORF) |
ORF040784 |
ABM |
1.0 ug DNA |
EUR 506 |
Cd151 ORF Vector (Mouse) (pORF) |
ORF040785 |
ABM |
1.0 ug DNA |
EUR 506 |
Cd151 ORF Vector (Rat) (pORF) |
ORF064615 |
ABM |
1.0 ug DNA |
EUR 506 |
CD151 ELISA Kit (Human) (OKCA01149) |
OKCA01149 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Essential for the proper assembly of the glomerular and tubular basement membranes in kidney.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.039 ng/mL |
CD151 sgRNA CRISPR Lentivector set (Human) |
K0405401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cd151 sgRNA CRISPR Lentivector set (Mouse) |
K4390601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cd151 sgRNA CRISPR Lentivector set (Rat) |
K6941101 |
ABM |
3 x 1.0 ug |
EUR 339 |
CD151 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0405402 |
ABM |
1.0 ug DNA |
EUR 154 |
CD151 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0405403 |
ABM |
1.0 ug DNA |
EUR 154 |
CD151 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0405404 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd151 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4390602 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd151 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4390603 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd151 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4390604 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd151 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6941102 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd151 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6941103 |
ABM |
1.0 ug DNA |
EUR 154 |
Cd151 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6941104 |
ABM |
1.0 ug DNA |
EUR 154 |
CD151 Protein Vector (Human) (pPB-C-His) |
PV008361 |
ABM |
500 ng |
EUR 329 |
CD151 Protein Vector (Human) (pPB-N-His) |
PV008362 |
ABM |
500 ng |
EUR 329 |
CD151 Protein Vector (Human) (pPM-C-HA) |
PV008363 |
ABM |
500 ng |
EUR 329 |
CD151 Protein Vector (Human) (pPM-C-His) |
PV008364 |
ABM |
500 ng |
EUR 329 |
CD151 Protein Vector (Rat) (pPB-C-His) |
PV258458 |
ABM |
500 ng |
EUR 603 |
CD151 Protein Vector (Rat) (pPB-N-His) |
PV258459 |
ABM |
500 ng |
EUR 603 |
CD151 Protein Vector (Rat) (pPM-C-HA) |
PV258460 |
ABM |
500 ng |
EUR 603 |
CD151 Protein Vector (Rat) (pPM-C-His) |
PV258461 |
ABM |
500 ng |
EUR 603 |
CD151 Protein Vector (Mouse) (pPB-C-His) |
PV163130 |
ABM |
500 ng |
EUR 603 |
CD151 Protein Vector (Mouse) (pPB-N-His) |
PV163131 |
ABM |
500 ng |
EUR 603 |
CD151 Protein Vector (Mouse) (pPM-C-HA) |
PV163132 |
ABM |
500 ng |
EUR 603 |
CD151 Protein Vector (Mouse) (pPM-C-His) |
PV163133 |
ABM |
500 ng |
EUR 603 |
CD151 Protein Vector (Mouse) (pPB-C-His) |
PV163134 |
ABM |
500 ng |
EUR 603 |
CD151 Rabbit Polyclonal Antibody