CD274 Rabbit Polyclonal Antibody

CD274 Rabbit Polyclonal Antibody

To Order:

CD274 Polyclonal Antibody
ABP58053-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CD274 protein at amino acid sequence of 181-230
  • Applications tips:
Description: A polyclonal antibody for detection of CD274 from Human. This CD274 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD274 protein at amino acid sequence of 181-230
CD274 Polyclonal Antibody
ABP58053-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CD274 protein at amino acid sequence of 181-230
  • Applications tips:
Description: A polyclonal antibody for detection of CD274 from Human. This CD274 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD274 protein at amino acid sequence of 181-230
CD274 Polyclonal Antibody
ABP58053-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD274 protein at amino acid sequence of 181-230
  • Applications tips:
Description: A polyclonal antibody for detection of CD274 from Human. This CD274 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD274 protein at amino acid sequence of 181-230
CD274 Polyclonal Antibody
ES8791-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD274 from Human. This antibody is tested and validated for IHC, WB, ELISA
CD274 Polyclonal Antibody
ES8791-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD274 from Human. This antibody is tested and validated for IHC, WB, ELISA
Polyclonal CD274 Antibody (C-term)
APR03998G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CD274 (C-term). This antibody is tested and proven to work in the following applications:
CD274 antibody
70R-16265 50 ul
EUR 435
Description: Rabbit polyclonal CD274 antibody
CD274 Antibody
32363-100ul 100ul
EUR 252
CD274 Antibody
43858-100ul 100ul
EUR 252
CD274 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CD274. Recognizes CD274 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CD274 Antibody
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD274. Recognizes CD274 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
CD274 Antibody
DF6526 200ul
EUR 304
Description: CD274 Antibody detects endogenous levels of total CD274.
CD274 Antibody
ABD6526 100 ug
EUR 438
274A-100T 100 test
EUR 408.8
274B-01MG 0,1 test
EUR 330.8
274CFB-100T 100 test
EUR 455.6
274F-100T 100 test
EUR 362
274PE-100T 100 test
EUR 440
274PU-01MG 0,1 test
EUR 252.8
PR27312 2 ug
EUR 191
Polyclonal CD274 Antibody - C-terminal region
APR01550G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CD274 - C-terminal region. This antibody is tested and proven to work in the following applications:
Anti-PD-L1 (CD274) Rabbit Monoclonal Antibody
M00109 100ug/vial
EUR 397
Description: Rabbit Monoclonal PD-L1 (CD274) Antibody. Validated in IHC-P, WB and tested in Human, Mouse, Rat.
CD274(PD1L1) Antibody
48238-100ul 100ul
EUR 333
CD274(PD1L1) Antibody
48238-50ul 50ul
EUR 239
CD274 Antibody (FITC)
abx140489-100tests 100 tests
EUR 425
  • Shipped within 5-12 working days.
Anti-CD274 antibody
STJ113753 100 µl
EUR 277
Description: This gene encodes an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Expression of this gene in tumor cells is considered to be prognostic in many types of human malignancies, including colon cancer and renal cell carcinoma. Alternative splicing results in multiple transcript variants.
Anti-CD274 antibody
STJ160016 1 mL C
EUR 544
Description: Programmed Death-Ligand 1 (PD-L1), also known as CD274 or B7 Homolog 1 (B7-H1), is a transmembrane protein involved in suppressing the immune system and rendering tumor cells resistant to CD8+ T cell-mediated lysis through binding of the Programmed Death-1 (PD-1) receptor. Overexpression of PD-L1 may allow cancer cells to evade the actions of the host immune system. In renal cell carcinoma, upregulation of PD-L1 has been linked to increased tumor aggressiveness and risk of death, and, in ovarian cancer, higher expression of this protein has lead to significantly poorer prognosis. PD-L1 has also been linked to systemic lupus erythematosus and cutaneous melanoma. When considered in adjunct with CD8+ tumor-infiltrating lymphocyte density, expression levels of PD-L1 may be a useful predictor of multiple cancer types, including stage III non-small cell lung cancer, hormone receptor negative breast cancer, and sentinel lymph node melanoma.
Anti-CD274 antibody
STJ22985 100 µl
EUR 277
Description: This gene encodes an immune inhibitory receptor ligand that is expressed by hematopoietic and non-hematopoietic cells, such as T cells and B cells and various types of tumor cells. The encoded protein is a type I transmembrane protein that has immunoglobulin V-like and C-like domains. Interaction of this ligand with its receptor inhibits T-cell activation and cytokine production. During infection or inflammation of normal tissue, this interaction is important for preventing autoimmunity by maintaining homeostasis of the immune response. In tumor microenvironments, this interaction provides an immune escape for tumor cells through cytotoxic T-cell inactivation. Expression of this gene in tumor cells is considered to be prognostic in many types of human malignancies, including colon cancer and renal cell carcinoma. Alternative splicing results in multiple transcript variants.
Anti-CD274 Antibody
STJ502399 100 µg
EUR 476
Anti-CD274 antibody
STJ98996 200 µl
EUR 197
Description: Rabbit polyclonal to CD274.
Polyclonal B7-H1 / PD-L1 / CD274 Antibody
APR03374G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human B7-H1 / PD-L1 / CD274 . This antibody is tested and proven to work in the following applications:
Polyclonal Goat Anti-CD274 / PD-L1 Antibody
APG00067G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-CD274 / PD-L1 . This antibody is tested and proven to work in the following applications:
Rabbit Anti-CD274 monoclonal antibody, clone KK19-06
CAB-722RH 100 ul
EUR 777
YF-PA26076 50 ul
EUR 334
Description: Mouse polyclonal to CD274
CD274(PD1L1) Conjugated Antibody
C48238 100ul
EUR 397
Anti-CD274 Antibody (Biotin)
STJ502400 100 µg
EUR 586
Anti-CD274 Antibody (FITC)
STJ502401 100 µg
EUR 586
Goat Anti Human Cd274 (C-Terminal) Polyclonal Antibody
CPBT-65080GH 0.1 mg
EUR 840
Anti-PD-L1 (CD274) (B7-H1), Rabbit Monoclonal Antibody
A1824-50 Ask for price
anti- PD-L1/CD274 antibody
FNab06280 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: CD274 molecule
  • Uniprot ID: Q9NZQ7
  • Research Area: Cancer, Immunology, Signal Transduction
Description: Antibody raised against PD-L1/CD274
anti- PD-L1/CD274 antibody
FNab06281 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:100-1:500
  • IF: 1:50-1:500
  • Immunogen: CD274 molecule
  • Uniprot ID: Q9NZQ7
  • Research Area: Cancer, Immunology, Signal Transduction
Description: Antibody raised against PD-L1/CD274
Anti-PD-L1/CD274 Antibody
PA1851 100ug/vial
EUR 294
Anti-PD-L1/CD274 antibody
PAab06280 100 ug
EUR 355
Anti-PD-L1/CD274 Antibody
PB9154 100ug/vial
EUR 294
Anti-PD-L1/CD274 Antibody
PB9994 100ug/vial
EUR 294
Anti-CD274 / PD-L1 antibody
STJ70646 100 µg
EUR 359
CD274 Blocking Peptide
DF6526-BP 1mg
EUR 195
CD274, mouse recombinant
EUR 370
PD-L1, CD274
E6TA00108 0.1mg
EUR 343
CD274 cloning plasmid
CSB-CL878942HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atgaggatatttgctgtctttatattcatgacctactggcatttgctgaacgcatttactgtcacggttcccaaggacctatatgtggtagagtatggtagcaatatgacaattgaatgcaaattcccagtagaaaaacaattagacctggctgcactaattgtctattgggaaat
  • Show more
Description: A cloning plasmid for the CD274 gene.
pDONR223-CD274 Plasmid
PVTB00385 2 ug
EUR 356
PVT14234 2 ug
EUR 495
PVT14476 2 ug
EUR 703
Mouse Anti Human Cd274 Monoclonal Antibody
CABT-47434MH 0.2 mg
EUR 767
Anti-CD274 / PD-L1, Biotinylated antibody
STJ73200 100 µg
EUR 359
Anti-PD-L1 (CD274) (B7-H1) Rabbit Monoclonal Antibody, Clone#RM320
M00109-1 100uL
EUR 427
Description: Anti-PD-L1 (CD274) (B7-H1) Rabbit Monoclonal Antibody, Clone#RM320 tested in WB, IHC, reactive to Human
Anti-Hu CD274 Purified
11-177-C025 0.025 mg
EUR 99
Anti-Hu CD274 Purified
11-177-C100 0.1 mg
EUR 158

CD274 Rabbit Polyclonal Antibody

Back To Top