CD300a Rabbit Polyclonal Antibody

CD300a Rabbit Polyclonal Antibody

To Order:

CD300a Polyclonal Antibody

ABP58059-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CD300a protein at amino acid sequence of 141-190
  • Applications tips:
Description: A polyclonal antibody for detection of CD300a from Human. This CD300a antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CD300a protein at amino acid sequence of 141-190

CD300A Rabbit pAb

A10006-100ul 100 ul
EUR 308

CD300A Rabbit pAb

A10006-200ul 200 ul
EUR 459

CD300A Rabbit pAb

A10006-20ul 20 ul
EUR 183

CD300A Rabbit pAb

A10006-50ul 50 ul
EUR 223

CD300A Antibody

ABD8434 100 ug
EUR 438

CD300A Antibody

45302-100ul 100ul
EUR 252

CD300A Antibody

45302-50ul 50ul
EUR 187

CD300A Antibody

DF8434 200ul
EUR 304
Description: CD300A Antibody detects endogenous levels of total CD300A.

CD300A Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD300A. Recognizes CD300A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CD300A Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CD300A. Recognizes CD300A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CD300a Antibody (APC)

abx140479-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

Anti-CD300a antibody

STJ98999 200 µl
EUR 197
Description: Rabbit polyclonal to CD300a.

Anti-CD300A antibody

STJ112046 100 µl
EUR 277
Description: This gene encodes a member of the CD300 glycoprotein family of cell surface proteins found on leukocytes involved in immune response signaling pathways. This gene is located on chromosome 17 in a cluster with all but one of the other family members. Multiple transcript variants encoding different isoforms have been found for this gene.

Cd300a/ Rat Cd300a ELISA Kit

ELI-50989r 96 Tests
EUR 886

CD300A Protein

  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

CD300A siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD300A siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27501 50 ug
EUR 363
Description: Mouse polyclonal to CD300A

CD300A, human recombinant

EUR 370

CD300A Blocking Peptide

DF8434-BP 1mg
EUR 195

CD300A cloning plasmid

CSB-CL887023HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 900
  • Sequence: atgtggctgccttgggctctgttgcttctctgggtcccaggatgttttgctctgagcaaatgcaggaccgtggcgggccccgtggggggatccctgagtgtgcagtgtccctatgagaaggaacacaggaccctcaacaaatactggtgcagaccaccacagattttcctatgtga
  • Show more
Description: A cloning plasmid for the CD300A gene.

Human CD300A (CLM-8) Antibody

33214-05111 150 ug
EUR 261

Rabbit CMRF35 like molecule 8(CD300A) ELISA kit

E04C1477-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CMRF35 like molecule 8(CD300A) ELISA kit

E04C1477-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CMRF35 like molecule 8(CD300A) ELISA kit

E04C1477-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Anti Human Cd300a Monoclonal Antibody

CABT-47528MH 0.1 mg
EUR 715

CMRF35-Like Molecule 8 (CD300A) Antibody

abx139997-01mg 0.1 mg
EUR 384
  • Shipped within 5-12 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

abx146214-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody

abx414508-01mg 0.1 mg
EUR 439
  • Shipped within 1 week.

CMRF35-Like Molecule 8 (CD300A) Antibody

abx415163-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Mouse CD300A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CD300A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CD300A protein (His tag)

80R-2938 50 ug
EUR 327
Description: Purified recombinant HMGB3 protein (His tag)

Anti-Hu CD300a Purified

11-501-C025 0.025 mg
EUR 108

Anti-Hu CD300a Purified

11-501-C100 0.1 mg
EUR 177

Anti-Hu CD300a APC

1A-501-T100 100 tests
EUR 240

Anti-Hu CD300a PE

1P-501-T025 25 tests
EUR 140

Anti-Hu CD300a PE

1P-501-T100 100 tests
EUR 240

CD300A Human Recombinant Protein

PROTQ9UGN4 Regular: 10ug
EUR 317
Description: CD300A Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 134 amino acids (18-128) and having a molecular mass of 14.7kDa.

Recombinant Human CD300A Protein

RP00265 10 μg
EUR 174

CD300A Recombinant Protein (Human)

RP006322 100 ug Ask for price

CD300A Recombinant Protein (Rat)

RP193922 100 ug Ask for price

CD300A Recombinant Protein (Mouse)

RP122504 100 ug Ask for price

CMRF35-Like Molecule 8 (CD300A) Antibody (PE)

abx139998-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

CMRF35-Like Molecule 8 (CD300A) Antibody (FITC)

abx415164-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

CMRF35-Like Molecule 8 (CD300A) Antibody (RPE)

abx415165-100tests 100 tests
EUR 592
  • Shipped within 1 week.

Human CD300A (CLM-8) Antibody (Biotin Conjugate)

33214-05121 150 ug
EUR 369

Human CD300A PicoKine ELISA Kit

EK1980 96 wells
EUR 425
Description: For quantitative detection of human CD300A in cell culture supernates, serum and plasma (heparin, EDTA).

Anti-Hu CD300a Alexa Fluor488

A4-501-T100 100 tests
EUR 269

CD300A ORF Vector (Human) (pORF)

ORF002108 1.0 ug DNA
EUR 95

Cd300a ORF Vector (Mouse) (pORF)

ORF040836 1.0 ug DNA
EUR 506

Cd300a ORF Vector (Rat) (pORF)

ORF064642 1.0 ug DNA
EUR 506

CD300A ELISA Kit (Human) (OKBB01351)

OKBB01351 96 Wells
EUR 505
Description: Description of target: CD300A (Cluster of Differentiation 300A) is a human gene. It is mapped to 17q25.1. This gene encodes a member of the CD300 glycoprotein family of cell surface proteins found on leukocytes involved in immune response signaling pathways. This gene is located on chromosome 17 in a cluster with all but one of the other family members. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Human CD300A (CLM-8) AssayLite Antibody (FITC Conjugate)

33214-05141 150 ug
EUR 428

Human CD300A (CLM-8) AssayLite Antibody (RPE Conjugate)

33214-05151 150 ug
EUR 428

Human CD300A (CLM-8) AssayLite Antibody (APC Conjugate)

33214-05161 150 ug
EUR 428

CD300a Rabbit Polyclonal Antibody

Back To Top