CD300a Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
CD300a Polyclonal Antibody |
ES8794-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD300a from Human. This antibody is tested and validated for IHC, WB, ELISA |
CD300A Rabbit pAb |
A10006-100ul |
Abclonal |
100 ul |
EUR 308 |
CD300A Rabbit pAb |
A10006-200ul |
Abclonal |
200 ul |
EUR 459 |
CD300A Rabbit pAb |
A10006-20ul |
Abclonal |
20 ul |
EUR 183 |
CD300A Rabbit pAb |
A10006-50ul |
Abclonal |
50 ul |
EUR 223 |
CD300A Antibody |
45302-100ul |
SAB |
100ul |
EUR 252 |
CD300A Antibody |
45302-50ul |
SAB |
50ul |
EUR 187 |
CD300A Antibody |
1-CSB-PA887023ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CD300A. Recognizes CD300A from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200 |
CD300A Antibody |
1-CSB-PA887023ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against CD300A. Recognizes CD300A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
CD300A Antibody |
DF8434 |
Affbiotech |
200ul |
EUR 304 |
Description: CD300A Antibody detects endogenous levels of total CD300A. |
CD300a Antibody (APC) |
abx140479-100tests |
Abbexa |
100 tests |
EUR 481 |
- Shipped within 5-12 working days.
|
Anti-CD300A antibody |
STJ112046 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the CD300 glycoprotein family of cell surface proteins found on leukocytes involved in immune response signaling pathways. This gene is located on chromosome 17 in a cluster with all but one of the other family members. Multiple transcript variants encoding different isoforms have been found for this gene. |
Anti-CD300a antibody |
STJ98999 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CD300a. |
CD300A Protein |
20-abx262674 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
CD300A siRNA |
20-abx910992 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CD300A siRNA |
20-abx910993 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CD300A |
YF-PA27501 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CD300A |
CD300A Blocking Peptide |
DF8434-BP |
Affbiotech |
1mg |
EUR 195 |
CD300A, human recombinant |
7341-50 |
Biovision |
|
EUR 370 |
CD300A cloning plasmid |
CSB-CL887023HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 900
- Sequence: atgtggctgccttgggctctgttgcttctctgggtcccaggatgttttgctctgagcaaatgcaggaccgtggcgggccccgtggggggatccctgagtgtgcagtgtccctatgagaaggaacacaggaccctcaacaaatactggtgcagaccaccacagattttcctatgtga
- Show more
|
Description: A cloning plasmid for the CD300A gene. |
Human CD300A (CLM-8) Antibody |
33214-05111 |
AssayPro |
150 ug |
EUR 261 |
Rabbit CMRF35 like molecule 8(CD300A) ELISA kit |
E04C1477-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit CMRF35 like molecule 8(CD300A) ELISA kit |
E04C1477-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit CMRF35 like molecule 8(CD300A) ELISA kit |
E04C1477-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
CMRF35-Like Molecule 8 (CD300A) Antibody |
20-abx135925 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
CMRF35-Like Molecule 8 (CD300A) Antibody |
abx146214-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
CMRF35-Like Molecule 8 (CD300A) Antibody |
20-abx149077 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CMRF35-Like Molecule 8 (CD300A) Antibody |
abx139997-01mg |
Abbexa |
0.1 mg |
EUR 384 |
- Shipped within 5-12 working days.
|
CMRF35-Like Molecule 8 (CD300A) Antibody |
abx414508-01mg |
Abbexa |
0.1 mg |
EUR 439 |
|
CMRF35-Like Molecule 8 (CD300A) Antibody |
20-abx321205 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CMRF35-Like Molecule 8 (CD300A) Antibody |
20-abx322634 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CMRF35-Like Molecule 8 (CD300A) Antibody |
abx415163-02mg |
Abbexa |
0.2 mg |
EUR 565 |
|
Anti-Hu CD300a Purified |
11-501-C025 |
ExBio |
0.025 mg |
EUR 108 |
Anti-Hu CD300a Purified |
11-501-C100 |
ExBio |
0.1 mg |
EUR 177 |
Anti-Hu CD300a APC |
1A-501-T100 |
ExBio |
100 tests |
EUR 240 |
Anti-Hu CD300a PE |
1P-501-T025 |
ExBio |
25 tests |
EUR 140 |
Anti-Hu CD300a PE |
1P-501-T100 |
ExBio |
100 tests |
EUR 240 |
CD300A protein (His tag) |
80R-2938 |
Fitzgerald |
50 ug |
EUR 327 |
Description: Purified recombinant HMGB3 protein (His tag) |
Human CD300A shRNA Plasmid |
20-abx957744 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse CD300A shRNA Plasmid |
20-abx981104 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CD300A Human Recombinant Protein |
PROTQ9UGN4 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: CD300A Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 134 amino acids (18-128) and having a molecular mass of 14.7kDa. |
Recombinant Human CD300A Protein |
RP00265 |
Abclonal |
10 μg |
EUR 174 |
CD300A Recombinant Protein (Human) |
RP006322 |
ABM |
100 ug |
Ask for price |
CD300A Recombinant Protein (Rat) |
RP193922 |
ABM |
100 ug |
Ask for price |
CD300A Recombinant Protein (Mouse) |
RP122504 |
ABM |
100 ug |
Ask for price |
Human CD300A (CLM-8) Antibody (Biotin Conjugate) |
33214-05121 |
AssayPro |
150 ug |
EUR 369 |
CMRF35-Like Molecule 8 (CD300A) Antibody (PE) |
abx139998-100tests |
Abbexa |
100 tests |
EUR 481 |
- Shipped within 5-12 working days.
|
CMRF35-Like Molecule 8 (CD300A) Antibody (FITC) |
abx415164-01mg |
Abbexa |
0.1 mg |
EUR 509 |
|
CMRF35-Like Molecule 8 (CD300A) Antibody (RPE) |
abx415165-100tests |
Abbexa |
100 tests |
EUR 592 |
|
Human CD300A PicoKine ELISA Kit |
EK1980 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human CD300A in cell culture supernates, serum and plasma (heparin, EDTA). |
Anti-Hu CD300a Alexa Fluor488 |
A4-501-T100 |
ExBio |
100 tests |
EUR 269 |
Cd300a ORF Vector (Rat) (pORF) |
ORF064642 |
ABM |
1.0 ug DNA |
EUR 506 |
CD300A ORF Vector (Human) (pORF) |
ORF002108 |
ABM |
1.0 ug DNA |
EUR 95 |
Cd300a ORF Vector (Mouse) (pORF) |
ORF040836 |
ABM |
1.0 ug DNA |
EUR 506 |
CD300A ELISA Kit (Human) (OKBB01351) |
OKBB01351 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: CD300A (Cluster of Differentiation 300A) is a human gene. It is mapped to 17q25.1. This gene encodes a member of the CD300 glycoprotein family of cell surface proteins found on leukocytes involved in immune response signaling pathways. This gene is located on chromosome 17 in a cluster with all but one of the other family members. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
Human CD300A (CLM-8) AssayLite Antibody (FITC Conjugate) |
33214-05141 |
AssayPro |
150 ug |
EUR 428 |
Human CD300A (CLM-8) AssayLite Antibody (RPE Conjugate) |
33214-05151 |
AssayPro |
150 ug |
EUR 428 |
Human CD300A (CLM-8) AssayLite Antibody (APC Conjugate) |
33214-05161 |
AssayPro |
150 ug |
EUR 428 |
CD300a Rabbit Polyclonal Antibody