CDH17 Rabbit Polyclonal Antibody

CDH17 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

CDH17 Polyclonal Antibody
ABP58080-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CDH17 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDH17 from Human, Mouse, Rat. This CDH17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDH17 protein

CDH17 Polyclonal Antibody
ABP58080-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CDH17 protein
  • Applications tips:
Description: A polyclonal antibody for detection of CDH17 from Human, Mouse, Rat. This CDH17 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDH17 protein

CDH17 Polyclonal Antibody
42643-100ul 100ul
EUR 333

Human Cadherin 17 (CDH17) ELISA Kit
DLR-CDH17-Hu-48T 48T
EUR 517
  • Should the Human Cadherin 17 (CDH17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cadherin 17 (CDH17) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cadherin 17 (CDH17) ELISA Kit
DLR-CDH17-Hu-96T 96T
EUR 673
  • Should the Human Cadherin 17 (CDH17) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cadherin 17 (CDH17) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Cadherin 17 (CDH17) ELISA Kit
RD-CDH17-Hu-48Tests 48 Tests
EUR 521

Human Cadherin 17 (CDH17) ELISA Kit
RD-CDH17-Hu-96Tests 96 Tests
EUR 723

Human Cadherin 17 (CDH17) ELISA Kit
RDR-CDH17-Hu-48Tests 48 Tests
EUR 544

Human Cadherin 17 (CDH17) ELISA Kit
RDR-CDH17-Hu-96Tests 96 Tests
EUR 756

CDH17 Rabbit pAb
A6555-100ul 100 ul
EUR 308

CDH17 Rabbit pAb
A6555-200ul 200 ul
EUR 459

CDH17 Rabbit pAb
A6555-20ul 20 ul
EUR 183

CDH17 Rabbit pAb
A6555-50ul 50 ul
EUR 223

CDH17 antibody
70R-32308 100 ug
EUR 327
Description: Rabbit polyclonal CDH17 antibody

CDH17 Antibody
ABD3526 100 ug
EUR 438

CDH17 Antibody
34177-100ul 100ul
EUR 252

CDH17 Antibody
34177-50ul 50ul
EUR 187

CDH17 Antibody
46450-100ul 100ul
EUR 252

CDH17 Antibody
DF3526 200ul
EUR 304
Description: CDH17 Antibody detects endogenous levels of total CDH17.

CDH17 Antibody
1-CSB-PA006407
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CDH17. Recognizes CDH17 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

CDH17 Antibody
1-CSB-PA613267ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CDH17. Recognizes CDH17 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CDH17 Antibody
CSB-PA212083-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CDH17. Recognizes CDH17 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

CDH17 Antibody
CSB-PA212083-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CDH17. Recognizes CDH17 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

CDH17 Conjugated Antibody
C46450 100ul
EUR 397

anti- CDH17 antibody
FNab01547 100µg
EUR 548.75
  • Recommended dilution: WB: 1:1000-1:10000
  • IHC: 1:20-1:200
  • Immunogen: cadherin 17, LI cadherin(liver-intestine)
  • Uniprot ID: Q12864
  • Gene ID: 1015
  • Research Area: Signal Transduction
Description: Antibody raised against CDH17

Anti-CDH17 antibody
PAab01547 100 ug
EUR 386

Anti-CDH17 antibody
STJ99641 200 µl
EUR 197
Description: Rabbit polyclonal to CDH17.

Anti-CDH17 antibody
STJ28638 100 µl
EUR 277
Description: This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants.

Anti-CDH17 Antibody
STJ500339 100 µg
EUR 476

Anti-CDH17 Antibody
STJ500340 100 µg
EUR 476

Cdh17/ Rat Cdh17 ELISA Kit
ELI-50369r 96 Tests
EUR 886

Cadherin 17 (CDH17) Polyclonal Antibody (Human, Mouse)
4-PAC002Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDH17 (Asp67~Glu351)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Cadherin 17 (CDH17)

Rabbit Cadherin 17(CDH17) ELISA kit
E04C1538-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cadherin 17(CDH17) ELISA kit
E04C1538-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Cadherin 17(CDH17) ELISA kit
E04C1538-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CDH17 siRNA
20-abx900950
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDH17 siRNA
20-abx911204
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CDH17 siRNA
20-abx911205
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CDH17
YF-PA23415 50 ul
EUR 334
Description: Mouse polyclonal to CDH17

Cadherin 17 (CDH17) Antibody
20-abx128826
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cadherin 17 (CDH17) Antibody
abx146163-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cadherin 17 (CDH17) Antibody
abx148801-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Cadherin 17 (CDH17) Antibody
20-abx006359
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cadherin 17 (CDH17) Antibody
20-abx013917
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Cadherin 17 (CDH17) Antibody
20-abx324911
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cadherin 17 (CDH17) Antibody
20-abx320172
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cadherin-17 (CDH17) Antibody
abx224125-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Cadherin 17 (CDH17) Antibody
abx330506-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Cadherin 17 (CDH17) Antibody
abx231547-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Cadherin 17 (CDH17) Antibody
20-abx171497
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Anti-CDH17 Antibody (Biotin)
STJ500341 100 µg
EUR 586

Anti-CDH17 Antibody (FITC)
STJ500342 100 µg
EUR 586

Anti-CDH17 Antibody (Biotin)
STJ500343 100 µg
EUR 586

Anti-CDH17 Antibody (FITC)
STJ500344 100 µg
EUR 586

Cadherin 17 (CDH17) Polyclonal Antibody (Human, Mouse), APC
4-PAC002Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDH17 (Asp67~Glu351)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Cadherin 17 (CDH17). This antibody is labeled with APC.

Cadherin 17 (CDH17) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAC002Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDH17 (Asp67~Glu351)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Cadherin 17 (CDH17). This antibody is labeled with Biotin.

Cadherin 17 (CDH17) Polyclonal Antibody (Human, Mouse), Cy3
4-PAC002Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDH17 (Asp67~Glu351)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Cadherin 17 (CDH17). This antibody is labeled with Cy3.

Cadherin 17 (CDH17) Polyclonal Antibody (Human, Mouse), FITC
4-PAC002Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDH17 (Asp67~Glu351)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Cadherin 17 (CDH17). This antibody is labeled with FITC.

Cadherin 17 (CDH17) Polyclonal Antibody (Human, Mouse), HRP
4-PAC002Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDH17 (Asp67~Glu351)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Cadherin 17 (CDH17). This antibody is labeled with HRP.

Cadherin 17 (CDH17) Polyclonal Antibody (Human, Mouse), PE
4-PAC002Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDH17 (Asp67~Glu351)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Cadherin 17 (CDH17). This antibody is labeled with PE.

CDH17 cloning plasmid
CSB-CL613267HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2499
  • Sequence: ATGATACTTCAGGCCCATCTTCACTCCCTGTGTCTTCTTATGCTTTATTTGGCAACTGGATATGGCCAAGAGGGGAAGTTTAGTGGACCCCTGAAACCCATGACATTTTCTATTTATGAAGGCCAAGAACCGAGTCAAATTATATTCCAGTTTAAGGCCAATCCTCCTGCTGTGA
  • Show more
Description: A cloning plasmid for the CDH17 gene.

CDH17 Blocking Peptide
DF3526-BP 1mg
EUR 195

Anti-CDH17 (1H3)
YF-MA10148 100 ug
EUR 363
Description: Mouse monoclonal to CDH17

Anti-CDH17 (3H2)
YF-MA10149 100 ug
EUR 363
Description: Mouse monoclonal to CDH17

Monoclonal CDH17 Antibody, Clone: 7D10E1
APR15395G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human CDH17. The antibodies are raised in Mouse and are from clone 7D10E1. This antibody is applicable in WB and IHC, E

Anti-LI Cadherin/CDH17 Antibody
PA2200 100ug/vial
EUR 294

Cadherin 17 (CDH17) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAC002Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CDH17 (Asp67~Glu351)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Cadherin 17 (CDH17). This antibody is labeled with APC-Cy7.

Rat CDH17 shRNA Plasmid
20-abx987391
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CDH17 ELISA KIT|Human
EF008565 96 Tests
EUR 689

Human CDH17 shRNA Plasmid
20-abx950728
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CDH17 shRNA Plasmid
20-abx969606
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Cadherin-17 (Cdh17)
1-CSB-EP882608MO
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 13.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Cadherin-17(Cdh17),partial expressed in E.coli

CDH17 Recombinant Protein (Human)
RP037942 100 ug Ask for price

Recombinant Cadherin 17 (CDH17)
4-RPC002Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q12864
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.8kDa
  • Isoelectric Point: 5.5
Description: Recombinant Human Cadherin 17 expressed in: E.coli

CDH17 Recombinant Protein (Rat)
RP194216 100 ug Ask for price

CDH17 Recombinant Protein (Mouse)
RP122966 100 ug Ask for price

Monoclonal CDH17 Antibody (monoclonal) (M01), Clone: 1H3
APR15397G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human CDH17 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H3. This antibody is applicable in WB and IHC, E

Human Cadherin 17 (CDH17) Protein
20-abx168091
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cdh17 ORF Vector (Mouse) (pORF)
ORF040990 1.0 ug DNA
EUR 506

CDH17 ORF Vector (Human) (pORF)
ORF012648 1.0 ug DNA
EUR 95

Cdh17 ORF Vector (Rat) (pORF)
ORF064740 1.0 ug DNA
EUR 506

CDH17 ELISA Kit (Human) (OKCD00757)
OKCD00757 96 Wells
EUR 831
Description: Description of target: Cadherins are calcium-dependent cell adhesion proteins. They preferentially interact with themselves in a homophilic manner in connecting cells; cadherins may thus contribute to the sorting of heterogeneous cell types. LI-cadherin may have a role in the morphological organization of liver and intestine. Involved in intestinal peptide transport.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.1"Association of intestinal peptide transport with a protein related to the cadherin superfamily."_x005F_x005F_x000D_Dantzig A.H., Hoskins J., Tabas L.B., Bright S., Shepard R.L., Jenkins I.L., Duckworth D.C., Sportsman J.R., MacKensen D., Rosteck P.R. Jr., Skatrud P.L._x005F_x005F_x000D_Science 264:430-433(1994) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA], FUNCTION, TISSUE SPECIFICITY, VARIANTS GLU-115 AND ASP-734. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 11.6 pg/mL

CDH17 ELISA Kit (Human) (OKAN06153)
OKAN06153 96 Wells
EUR 792
Description: Description of target: This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 14.1 pg/mL

Cdh17 ELISA Kit (Mouse) (OKBB01368)
OKBB01368 96 Wells
EUR 505
Description: Description of target: Cadherin-17 is a protein that in humans is encoded by the CDH17 gene. It is mapped to 4; 4 A1. This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

CDH17 ELISA Kit (Human) (OKDD00177)
OKDD00177 96 Wells
EUR 975
Description: Description of target: This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. The encoded protein is cadherin-like, consisting of an extracellular region, containing 7 cadherin domains, and a transmembrane region but lacking the conserved cytoplasmic domain. The protein is a component of the gastrointestinal tract and pancreatic ducts, acting as an intestinal proton-dependent peptide transporter in the first step in oral absorption of many medically important peptide-based drugs. The protein may also play a role in the morphological organization of liver and intestine. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.054 ng/mL

Goat Cadherin 17(CDH17) ELISA kit
E06C1538-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cadherin 17(CDH17) ELISA kit
E06C1538-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cadherin 17(CDH17) ELISA kit
E06C1538-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cadherin 17(CDH17) ELISA kit
E02C1538-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cadherin 17(CDH17) ELISA kit
E02C1538-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cadherin 17(CDH17) ELISA kit
E02C1538-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cadherin 17(CDH17) ELISA kit
E03C1538-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cadherin 17(CDH17) ELISA kit
E03C1538-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cadherin 17(CDH17) ELISA kit
E03C1538-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cadherin 17(CDH17) ELISA kit
E01C1538-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cadherin 17(CDH17) ELISA kit
E01C1538-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cadherin 17(CDH17) ELISA kit
E01C1538-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cadherin 17(CDH17) ELISA kit
E07C1538-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cadherin 17(CDH17) ELISA kit
E07C1538-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Cadherin 17(CDH17) ELISA kit
E07C1538-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cadherin 17(CDH17) ELISA kit
E08C1538-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cadherin 17(CDH17) ELISA kit
E08C1538-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Cadherin 17(CDH17) ELISA kit
E08C1538-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cadherin 17(CDH17) ELISA kit
E09C1538-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cadherin 17(CDH17) ELISA kit
E09C1538-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Cadherin 17(CDH17) ELISA kit
E09C1538-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cadherin- 17, CDH17 ELISA KIT
ELI-33004h 96 Tests
EUR 824

Mouse Cadherin- 17, Cdh17 ELISA KIT
ELI-33425m 96 Tests
EUR 865

CDH17 sgRNA CRISPR Lentivector set (Human)
K0415901 3 x 1.0 ug
EUR 339

Human Cadherin 17 (CDH17) ELISA Kit
20-abx150890
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Cadherin 17 (CDH17) CLIA Kit
20-abx493355
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Cdh17 sgRNA CRISPR Lentivector set (Mouse)
K3874501 3 x 1.0 ug
EUR 339

Cdh17 sgRNA CRISPR Lentivector set (Rat)
K7049201 3 x 1.0 ug
EUR 339

Human Cadherin 17 (CDH17) ELISA Kit
SEC002Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cadherin 17 (CDH17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cadherin 17 (CDH17) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cadherin 17 (CDH17) ELISA Kit
SEC002Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cadherin 17 (CDH17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cadherin 17 (CDH17) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cadherin 17 (CDH17) ELISA Kit
SEC002Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cadherin 17 (CDH17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cadherin 17 (CDH17) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cadherin 17 (CDH17) ELISA Kit
SEC002Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cadherin 17 (CDH17) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cadherin 17 (CDH17) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Cadherin 17 (CDH17) ELISA Kit
4-SEC002Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cadherin 17 elisa. Alternative names of the recognized antigen: CDH16
  • HPT-1
  • HPT1
  • LI-Cadherin
  • Cadherin, Liver Intestine
  • Intestinal peptide-associated transporter HPT-1
  • Liver-intestine cadherin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cadherin 17 (CDH17) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Cadherin 17 ELISA Kit (CDH17)
RK01076 96 Tests
EUR 521

Human Cadherin 17(CDH17)ELISA Kit
QY-E03404 96T
EUR 361

Monoclonal CDH17 / Cadherin 17 Antibody (clone 1H3), Clone: 1H3
APR15393G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human CDH17 / Cadherin 17 (clone 1H3). The antibodies are raised in Mouse and are from clone 1H3. This antibody is applicable in WB and IHC-P, E

Monoclonal CDH17 / Cadherin 17 Antibody (clone 3H2), Clone: 3H2
APR15394G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human CDH17 / Cadherin 17 (clone 3H2). The antibodies are raised in Mouse and are from clone 3H2. This antibody is applicable in WB and IHC-P, E

Guinea pig Cadherin 17(CDH17) ELISA kit
E05C1538-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cadherin 17(CDH17) ELISA kit
E05C1538-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Cadherin 17(CDH17) ELISA kit
E05C1538-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Cadherin 17(CDH17) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human CDH17 (Cadherin 17)
ELK2743 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cadherin 17 (CDH17). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cadherin 17 (C
  • Show more
Description: A sandwich ELISA kit for detection of Cadherin 17 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CDH17 sgRNA CRISPR Lentivector (Human) (Target 1)
K0415902 1.0 ug DNA
EUR 154

CDH17 sgRNA CRISPR Lentivector (Human) (Target 2)
K0415903 1.0 ug DNA
EUR 154

CDH17 sgRNA CRISPR Lentivector (Human) (Target 3)
K0415904 1.0 ug DNA
EUR 154

Cdh17 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3874502 1.0 ug DNA
EUR 154

Cdh17 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3874503 1.0 ug DNA
EUR 154

Cdh17 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3874504 1.0 ug DNA
EUR 154

Cdh17 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7049202 1.0 ug DNA
EUR 154

Cdh17 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7049203 1.0 ug DNA
EUR 154

Cdh17 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7049204 1.0 ug DNA
EUR 154

CDH17 Protein Vector (Human) (pPB-C-His)
PV050589 500 ng
EUR 481

CDH17 Protein Vector (Human) (pPB-N-His)
PV050590 500 ng
EUR 481

CDH17 Protein Vector (Human) (pPM-C-HA)
PV050591 500 ng
EUR 481

CDH17 Protein Vector (Human) (pPM-C-His)
PV050592 500 ng
EUR 481

CDH17 Protein Vector (Rat) (pPB-C-His)
PV258958 500 ng
EUR 1166

CDH17 Protein Vector (Rat) (pPB-N-His)
PV258959 500 ng
EUR 1166

CDH17 Protein Vector (Rat) (pPM-C-HA)
PV258960 500 ng
EUR 1166

CDH17 Protein Vector (Rat) (pPM-C-His)
PV258961 500 ng
EUR 1166

CDH17 Protein Vector (Mouse) (pPB-C-His)
PV163958 500 ng
EUR 1065

CDH17 Protein Vector (Mouse) (pPB-N-His)
PV163959 500 ng
EUR 1065

CDH17 Protein Vector (Mouse) (pPM-C-HA)
PV163960 500 ng
EUR 1065

CDH17 Protein Vector (Mouse) (pPM-C-His)
PV163961 500 ng
EUR 1065

Cdh17 3'UTR Luciferase Stable Cell Line
TU202067 1.0 ml Ask for price

Cdh17 3'UTR GFP Stable Cell Line
TU153594 1.0 ml Ask for price

CDH17 3'UTR Luciferase Stable Cell Line
TU004029 1.0 ml
EUR 1394

Cdh17 3'UTR Luciferase Stable Cell Line
TU103594 1.0 ml Ask for price

CDH17 3'UTR GFP Stable Cell Line
TU054029 1.0 ml
EUR 1394

Cdh17 3'UTR GFP Stable Cell Line
TU252067 1.0 ml Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CDH17 Rabbit Polyclonal Antibody

Back To Top