CDKN3 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
CDKN3 Polyclonal Antibody |
ES4465-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CDKN3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
CDKN3 Polyclonal Antibody |
ES4465-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CDKN3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
CDKN3 Polyclonal Antibody |
ABP58093-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human CDKN3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse, Rat. This CDKN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDKN3 protein |
CDKN3 Polyclonal Antibody |
ABP58093-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human CDKN3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse, Rat. This CDKN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDKN3 protein |
CDKN3 Polyclonal Antibody |
ABP58093-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human CDKN3 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse, Rat. This CDKN3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CDKN3 protein |
CDKN3 Polyclonal Antibody |
ABP53466-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80
- Applications tips:
|
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse. This CDKN3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80 |
CDKN3 Polyclonal Antibody |
ABP53466-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80
- Applications tips:
|
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse. This CDKN3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80 |
CDKN3 Polyclonal Antibody |
ABP53466-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80
- Applications tips:
|
Description: A polyclonal antibody for detection of CDKN3 from Human, Mouse. This CDKN3 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CDKN3 at AA rangle: 1-80 |
CDKN3 Polyclonal Antibody |
40724-100ul |
SAB |
100ul |
EUR 252 |
CDKN3 Polyclonal Antibody |
40724-50ul |
SAB |
50ul |
EUR 187 |
CDKN3 Rabbit pAb |
A2061-100ul |
Abclonal |
100 ul |
EUR 308 |
CDKN3 Rabbit pAb |
A2061-200ul |
Abclonal |
200 ul |
EUR 459 |
CDKN3 Rabbit pAb |
A2061-20ul |
Abclonal |
20 ul |
EUR 183 |
CDKN3 Rabbit pAb |
A2061-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit |
DLR-CDKN3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) in samples from tissue homogenates or other biological fluids. |
Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit |
DLR-CDKN3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) in samples from tissue homogenates or other biological fluids. |
Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit |
RD-CDKN3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit |
RD-CDKN3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit |
RDR-CDKN3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit |
RDR-CDKN3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
CDKN3 antibody |
70R-5506 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal CDKN3 antibody |
CDKN3 antibody |
70R-31929 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal CDKN3 antibody |
CDKN3 Antibody |
32578-100ul |
SAB |
100ul |
EUR 252 |
CDKN3 antibody |
10R-3660 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal CDKN3 antibody |
CDKN3 antibody |
10R-3661 |
Fitzgerald |
100 ul |
EUR 726 |
Description: Mouse monoclonal CDKN3 antibody |
CDKN3 antibody |
10R-3662 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal CDKN3 antibody |
CDKN3 antibody |
10R-3663 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal CDKN3 antibody |
CDKN3 antibody |
10R-3664 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal CDKN3 antibody |
CDKN3 antibody |
10R-3665 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal CDKN3 antibody |
CDKN3 antibody |
10R-3666 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal CDKN3 antibody |
CDKN3 Antibody |
DF6791 |
Affbiotech |
200ul |
EUR 304 |
Description: CDKN3 Antibody detects endogenous levels of total CDKN3. |
CDKN3 Antibody |
CSB-PA005096KA01HU- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
CDKN3 Antibody |
CSB-PA005096KA01HU-100ul |
Cusabio |
100ul |
EUR 389 |
- Form: liquid
- Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
|
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200 |
CDKN3 Antibody |
1-CSB-PA005096LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
CDKN3 Antibody |
1-CSB-PA006489 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
Polyclonal Cdkn3 antibody - N-terminal region |
APR01218G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Cdkn3 - N-terminal region. This antibody is tested and proven to work in the following applications: |
CDKN3 Conjugated Antibody |
C32578 |
SAB |
100ul |
EUR 397 |
Anti-CDKN3 Antibody |
A05157 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for CDKN3 Antibody (CDKN3) detection.tested for WB in Human, Mouse. |
Anti-CDKN3 antibody |
STJ92208 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CDKN3. |
Anti-CDKN3 antibody |
STJ99640 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to CDKN3. |
Anti-CDKN3 antibody |
STJ23083 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. |
CDKN3 siRNA |
20-abx900980 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDKN3 siRNA |
20-abx911332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CDKN3 siRNA |
20-abx911333 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-CDKN3 |
YF-PA10887 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to CDKN3 |
anti-CDKN3 |
YF-PA10888 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to CDKN3 |
anti-CDKN3 |
YF-PA23429 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to CDKN3 |
CDKN3 Antibody, HRP conjugated |
1-CSB-PA005096LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
CDKN3 Antibody, FITC conjugated |
1-CSB-PA005096LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
CDKN3 Antibody, Biotin conjugated |
1-CSB-PA005096LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against CDKN3. Recognizes CDKN3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
CDKN3 cloning plasmid |
CSB-CL005096HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 519
- Sequence: atgaagccgcccagttcaatacaaacaagttgtaaatttaaagatgttagaagaaatgtccaaaaagatacagaagaactaaagagctgtggtatacaagacatatttgttttctgcaccagaggggaactgtcaaaatatagagtcccaaaccttctggatctctaccagcaatg
- Show more
|
Description: A cloning plasmid for the CDKN3 gene. |
CDKN3 Blocking Peptide |
33R-1720 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CDKN3 antibody, catalog no. 70R-5506 |
CDKN3 Blocking Peptide |
DF6791-BP |
Affbiotech |
1mg |
EUR 195 |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human) |
4-PAC368Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDKN3 (Met1~Arg212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3) |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), APC |
4-PAC368Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDKN3 (Met1~Arg212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with APC. |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), Biotinylated |
4-PAC368Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDKN3 (Met1~Arg212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with Biotin. |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), Cy3 |
4-PAC368Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDKN3 (Met1~Arg212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with Cy3. |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), FITC |
4-PAC368Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDKN3 (Met1~Arg212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with FITC. |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), HRP |
4-PAC368Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDKN3 (Met1~Arg212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with HRP. |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), PE |
4-PAC368Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDKN3 (Met1~Arg212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with PE. |
CDKN3 Cell ELISA Kit |
abx595870-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Mouse CDKN3 shRNA Plasmid |
20-abx977752 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat CDKN3 shRNA Plasmid |
20-abx988421 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human CDKN3 shRNA Plasmid |
20-abx950746 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
CDKN3 protein (His tag) |
80R-1586 |
Fitzgerald |
100 ug |
EUR 397 |
Description: Purified recombinant Human CDKN3 protein |
CDKN3 Recombinant Protein (Human) |
RP006694 |
ABM |
100 ug |
Ask for price |
CDKN3 Recombinant Protein (Rat) |
RP194390 |
ABM |
100 ug |
Ask for price |
CDKN3 Recombinant Protein (Mouse) |
RP123212 |
ABM |
100 ug |
Ask for price |
Rabbit Cyclin Dependent Kinase Inhibitor 3 (CDKN3) ELISA Kit |
abx363507-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) ELISA kit |
E04C1578-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) ELISA kit |
E04C1578-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) ELISA kit |
E04C1578-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Cyclin dependent kinase inhibitor 3(CDKN3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC368Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: CDKN3 (Met1~Arg212)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Cyclin Dependent Kinase Inhibitor 3 (CDKN3). This antibody is labeled with APC-Cy7. |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody |
20-abx128074 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody |
abx117191-100ug |
Abbexa |
100 ug |
EUR 467 |
- Shipped within 5-10 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody |
20-abx001678 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody |
abx033454-400ul |
Abbexa |
400 ul |
EUR 551 |
- Shipped within 5-10 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody |
abx033454-80l |
Abbexa |
80 µl |
EUR 321 |
- Shipped within 5-10 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody |
20-abx325855 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody |
20-abx333837 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody |
20-abx225100 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody |
20-abx171985 |
Abbexa |
|
|
|
CDKN3 Colorimetric Cell-Based ELISA |
EKC1837 |
BosterBio |
100ul |
EUR 572 |
CDKN3 ORF Vector (Human) (pORF) |
ORF002232 |
ABM |
1.0 ug DNA |
EUR 95 |
Cdkn3 ORF Vector (Mouse) (pORF) |
ORF041072 |
ABM |
1.0 ug DNA |
EUR 506 |
Cdkn3 ORF Vector (Rat) (pORF) |
ORF064798 |
ABM |
1.0 ug DNA |
EUR 506 |
CDKN3 ELISA Kit (Human) (OKCD01665) |
OKCD01665 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May play a role in cell cycle regulation. Dual specificity phosphatase active toward substrates containing either phosphotyrosine or phosphoserine residues. Dephosphorylates CDK2 at 'Thr-160' in a cyclin-dependent manner.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL |
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody (HRP) |
20-abx335232 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody (FITC) |
20-abx335233 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cyclin Dependent Kinase Inhibitor 3 (CDKN3) Antibody (Biotin) |
20-abx335234 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
CDKN3 sgRNA CRISPR Lentivector set (Human) |
K0420501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cdkn3 sgRNA CRISPR Lentivector set (Mouse) |
K3512801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Cdkn3 sgRNA CRISPR Lentivector set (Rat) |
K6267201 |
ABM |
3 x 1.0 ug |
EUR 339 |
CDKN3 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0420502 |
ABM |
1.0 ug DNA |
EUR 154 |
CDKN3 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0420503 |
ABM |
1.0 ug DNA |
EUR 154 |
CDKN3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0420504 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdkn3 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3512802 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdkn3 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3512803 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdkn3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3512804 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdkn3 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6267202 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdkn3 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6267203 |
ABM |
1.0 ug DNA |
EUR 154 |
Cdkn3 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6267204 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Cyclin-dependent kinase inhibitor 3 (CDKN3) |
1-CSB-YP005096HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 25.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Cyclin-dependent kinase inhibitor 3(CDKN3) expressed in Yeast |
Recombinant Cyclin Dependent Kinase Inhibitor 3 (CDKN3) |
4-RPC368Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q16667
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 53.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Cyclin Dependent Kinase Inhibitor 3 expressed in: E.coli |
Recombinant Human CDKN3 Protein, His, E.coli-1mg |
QP11379-1mg |
EnQuireBio |
1mg |
EUR 3655 |
Recombinant Human CDKN3 Protein, His, E.coli-20ug |
QP11379-20ug |
EnQuireBio |
20ug |
EUR 201 |
Recombinant Human CDKN3 Protein, His, E.coli-5ug |
QP11379-5ug |
EnQuireBio |
5ug |
EUR 155 |
CDKN3 Protein Vector (Human) (pPB-C-His) |
PV008925 |
ABM |
500 ng |
EUR 329 |
CDKN3 Protein Vector (Human) (pPB-N-His) |
PV008926 |
ABM |
500 ng |
EUR 329 |
CDKN3 Protein Vector (Human) (pPM-C-HA) |
PV008927 |
ABM |
500 ng |
EUR 329 |
CDKN3 Protein Vector (Human) (pPM-C-His) |
PV008928 |
ABM |
500 ng |
EUR 329 |
CDKN3 Protein Vector (Rat) (pPB-C-His) |
PV259190 |
ABM |
500 ng |
EUR 603 |
CDKN3 Protein Vector (Rat) (pPB-N-His) |
PV259191 |
ABM |
500 ng |
EUR 603 |
CDKN3 Protein Vector (Rat) (pPM-C-HA) |
PV259192 |
ABM |
500 ng |
EUR 603 |
CDKN3 Protein Vector (Rat) (pPM-C-His) |
PV259193 |
ABM |
500 ng |
EUR 603 |
CDKN3 Protein Vector (Mouse) (pPB-C-His) |
PV164286 |
ABM |
500 ng |
EUR 603 |
CDKN3 Protein Vector (Mouse) (pPB-N-His) |
PV164287 |
ABM |
500 ng |
EUR 603 |
CDKN3 Protein Vector (Mouse) (pPM-C-HA) |
PV164288 |
ABM |
500 ng |
EUR 603 |
CDKN3 Protein Vector (Mouse) (pPM-C-His) |
PV164289 |
ABM |
500 ng |
EUR 603 |
Cdkn3 3'UTR Luciferase Stable Cell Line |
TU202122 |
ABM |
1.0 ml |
Ask for price |
Cdkn3 3'UTR GFP Stable Cell Line |
TU153656 |
ABM |
1.0 ml |
Ask for price |
CDKN3 3'UTR Luciferase Stable Cell Line |
TU004094 |
ABM |
1.0 ml |
EUR 1394 |
Cdkn3 3'UTR Luciferase Stable Cell Line |
TU103656 |
ABM |
1.0 ml |
Ask for price |
CDKN3 3'UTR GFP Stable Cell Line |
TU054094 |
ABM |
1.0 ml |
EUR 1394 |
Cdkn3 3'UTR GFP Stable Cell Line |
TU252122 |
ABM |
1.0 ml |
Ask for price |
CDKN3 Colorimetric Cell-Based ELISA Kit (OKAG01360) |
OKAG01360 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
Description: Description of target: ;Species reactivity: Human, Mouse;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity: |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
WIPI2 Rabbit Polyclonal Antibody |
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Gab1 Rabbit Polyclonal Antibody |
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ERK1 Rabbit Polyclonal Antibody |
ES8583-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
CDKN3 Rabbit Polyclonal Antibody