CHD1 Rabbit Polyclonal Antibody

CHD1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

CHD1 Polyclonal Antibody
ES9021-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CHD1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
CHD1 Polyclonal Antibody
ABP58135-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
  • Applications tips:
Description: A polyclonal antibody for detection of CHD1 from Human, Mouse. This CHD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
CHD1 Polyclonal Antibody
ABP58135-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
  • Applications tips:
Description: A polyclonal antibody for detection of CHD1 from Human, Mouse. This CHD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
CHD1 Polyclonal Antibody
ABP58135-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
  • Applications tips:
Description: A polyclonal antibody for detection of CHD1 from Human, Mouse. This CHD1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CHD1 protein at amino acid sequence of 960-1040
CHD1 Polyclonal Antibody
A68314 100 µl
EUR 483.55
Description: Ask the seller for details
Chd1 polyclonal antibody
6859-25
EUR 251
CHD1 Rabbit pAb
A15038-100ul 100 ul
EUR 308
CHD1 Rabbit pAb
A15038-200ul 200 ul
EUR 459
CHD1 Rabbit pAb
A15038-20ul 20 ul
EUR 183
CHD1 Rabbit pAb
A15038-50ul 50 ul
EUR 223
CHD1 Polyclonal Conjugated Antibody
C31368 100ul
EUR 397
CHD1 Antibody
ABD8753 100 ug
EUR 438
CHD1 Antibody
45469-100ul 100ul
EUR 252
CHD1 Antibody
45469-50ul 50ul
EUR 187
CHD1 antibody
70R-16384 50 ul
EUR 435
Description: Rabbit polyclonal CHD1 antibody
CHD1 Antibody
DF8753 200ul
EUR 304
Description: CHD1 Antibody detects endogenous levels of total CHD1.
CHD1 Antibody
1-CSB-PA005325ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CHD1. Recognizes CHD1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, ChIP; Recommended dilution: IHC:1:20-1:200
CHD1 Antibody
1-CSB-PA005325GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHD1. Recognizes CHD1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
[KO Validated] CHD1 Polyclonal Antibody
31368-100ul 100ul
EUR 252
[KO Validated] CHD1 Polyclonal Antibody
31368-50ul 50ul
EUR 187
[KO Validated] CHD1 Rabbit pAb
A7883-100ul 100 ul
EUR 410
[KO Validated] CHD1 Rabbit pAb
A7883-200ul 200 ul
EUR 571
[KO Validated] CHD1 Rabbit pAb
A7883-20ul 20 ul
EUR 221
[KO Validated] CHD1 Rabbit pAb
A7883-50ul 50 ul
EUR 287
CHD1 Conjugated Antibody
C45469 100ul
EUR 397
anti- CHD1 antibody
FNab01640 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: chromodomain helicase DNA binding protein 1
  • Uniprot ID: O14646
  • Gene ID: 1105
  • Research Area: Stem Cells, Metabolism
Description: Antibody raised against CHD1
Anti-CHD1 antibody
PAab01640 100 ug
EUR 386
Anti-CHD1 antibody
STJ110193 100 µl
EUR 413
Description: The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template.
Anti-CHD1 antibody
STJ117232 100 µl
EUR 277
Description: The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template.
Anti-CHD1 antibody
STJ190179 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to CHD1
CHD1 siRNA
20-abx911659
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CHD1 siRNA
20-abx911660
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CHD1
YF-PA23444 50 ul
EUR 334
Description: Mouse polyclonal to CHD1
Anti-CHD1 (internal) antibody
STJ71194 100 µg
EUR 260
CHD1 cloning plasmid
CSB-CL005325HU-10ug 10ug
EUR 2770
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 5130
  • Sequence: atgaatggacacagtgatgaagaaagtgttagaaacagtagtggagaatcaagccagtcggatgatgattctgggtcagcttcaggctctggatctggttcgagttctggaagcagtagtgatggaagcagtagccagtcaggtagcagtgactctgactccggatctgaatcag
  • Show more
Description: A cloning plasmid for the CHD1 gene.
CHD1 Blocking Peptide
DF8753-BP 1mg
EUR 195
Anti-CHD1 (1G2)
YF-MA12434 50 ug
EUR 363
Description: Mouse monoclonal to CHD1
Chromodomain helicase DNA binding protein 1 (CHD1) polyclonal antibody
ABP-'PAB-10568 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:
Chromodomain helicase DNA binding protein 1 (Chd1) polyclonal antibody
ABP-PAB-10569 100 ug Ask for price
    • Product line: Genetic Disease Markers
    • Brand:
Mouse Chd1 ELISA KIT
ELI-11179m 96 Tests
EUR 865
Human CHD1 ELISA KIT
ELI-25745h 96 Tests
EUR 824
CHD1 ELISA KIT|Human
EF008630 96 Tests
EUR 689
Chicken CHD1 ELISA KIT
ELI-50729c 96 Tests
EUR 928
Human CHD1 shRNA Plasmid
20-abx950787
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CHD1 shRNA Plasmid
20-abx969659
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Chd1 ORF Vector (Mouse) (pORF)
ORF041283 1.0 ug DNA
EUR 1572
CHD1 ORF Vector (Human) (pORF)
ORF012676 1.0 ug DNA
EUR 95
Chd1 ORF Vector (Rat) (pORF)
ORF064933 1.0 ug DNA
EUR 2080
pECMV-Chd1-m-FLAG Plasmid
PVT15589 2 ug
EUR 325
Rabbit Chromodomain helicase DNA binding protein 1(CHD1) ELISA kit
E04C1664-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chromodomain helicase DNA binding protein 1(CHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Chromodomain helicase DNA binding protein 1(CHD1) ELISA kit
E04C1664-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chromodomain helicase DNA binding protein 1(CHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Chromodomain helicase DNA binding protein 1(CHD1) ELISA kit
E04C1664-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Chromodomain helicase DNA binding protein 1(CHD1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody
20-abx111636
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody
20-abx149277
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody
20-abx006569
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody
20-abx321745
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody
abx431160-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
Chromodomain Helicase DNA Binding Protein 1 (CHD1) Antibody
abx231640-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
CHD1 sgRNA CRISPR Lentivector set (Human)
K0442601 3 x 1.0 ug
EUR 339
Chd1 sgRNA CRISPR Lentivector set (Mouse)
K4881901 3 x 1.0 ug
EUR 339
Chd1 sgRNA CRISPR Lentivector set (Rat)
K6344201 3 x 1.0 ug
EUR 339
CHD1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0442602 1.0 ug DNA
EUR 154
CHD1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0442603 1.0 ug DNA
EUR 154
CHD1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0442604 1.0 ug DNA
EUR 154
Chd1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4881902 1.0 ug DNA
EUR 154
Chd1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4881903 1.0 ug DNA
EUR 154
Chd1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4881904 1.0 ug DNA
EUR 154
Chd1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6344202 1.0 ug DNA
EUR 154
Chd1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6344203 1.0 ug DNA
EUR 154
Chd1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6344204 1.0 ug DNA
EUR 154
CHD1 Protein Vector (Human) (pPB-C-His)
PV050701 500 ng
EUR 481
CHD1 Protein Vector (Human) (pPB-N-His)
PV050702 500 ng
EUR 481
CHD1 Protein Vector (Human) (pPM-C-HA)
PV050703 500 ng
EUR 481
CHD1 Protein Vector (Human) (pPM-C-His)
PV050704 500 ng
EUR 481
CHD1 Protein Vector (Rat) (pPB-C-His)
PV259730 500 ng
EUR 2859
CHD1 Protein Vector (Rat) (pPB-N-His)
PV259731 500 ng
EUR 2859
CHD1 Protein Vector (Rat) (pPM-C-HA)
PV259732 500 ng
EUR 2859
CHD1 Protein Vector (Rat) (pPM-C-His)
PV259733 500 ng
EUR 2859
CHD1 Protein Vector (Mouse) (pPB-C-His)
PV165130 500 ng
EUR 2859
CHD1 Protein Vector (Mouse) (pPB-N-His)
PV165131 500 ng
EUR 2859
CHD1 Protein Vector (Mouse) (pPM-C-HA)
PV165132 500 ng
EUR 2859
CHD1 Protein Vector (Mouse) (pPM-C-His)
PV165133 500 ng
EUR 2859
Chd1 3'UTR Luciferase Stable Cell Line
TU202264 1.0 ml Ask for price
Chd1 3'UTR GFP Stable Cell Line
TU153812 1.0 ml Ask for price
CHD1 3'UTR Luciferase Stable Cell Line
TU004327 1.0 ml
EUR 1394
Chd1 3'UTR Luciferase Stable Cell Line
TU103812 1.0 ml Ask for price
CHD1 3'UTR GFP Stable Cell Line
TU054327 1.0 ml
EUR 1394
Chd1 3'UTR GFP Stable Cell Line
TU252264 1.0 ml Ask for price
CHD1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV669667 1.0 ug DNA
EUR 2665
CHD1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV669671 1.0 ug DNA
EUR 2665
CHD1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV669672 1.0 ug DNA
EUR 2665
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CHD1 Rabbit Polyclonal Antibody

Back To Top