CNPY3 Rabbit Polyclonal Antibody

CNPY3 Rabbit Polyclonal Antibody

To Order:

CNPY3 Polyclonal Antibody

ABP58210-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human CNPY3 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of CNPY3 from Human, Mouse. This CNPY3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CNPY3 protein at amino acid sequence of 1-50

CNPY3 Rabbit pAb

A7176-100ul 100 ul
EUR 308

CNPY3 Rabbit pAb

A7176-200ul 200 ul
EUR 459

CNPY3 Rabbit pAb

A7176-20ul 20 ul
EUR 183

CNPY3 Rabbit pAb

A7176-50ul 50 ul
EUR 223

CNPY3 Antibody

47291-100ul 100ul
EUR 252

CNPY3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNPY3. Recognizes CNPY3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CNPY3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CNPY3. Recognizes CNPY3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

Polyclonal CNPY3 Antibody (N-term)

APR04336G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CNPY3 (N-term). This antibody is tested and proven to work in the following applications:

CNPY3 Conjugated Antibody

C47291 100ul
EUR 397

anti- CNPY3 antibody

FNab01816 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: canopy 3 homolog (zebrafish)
  • Uniprot ID: Q9BT09
  • Gene ID: 10695
  • Research Area: Neuroscience
Description: Antibody raised against CNPY3

Anti-CNPY3 antibody

PAab01816 100 ug
EUR 355

Anti-CNPY3 antibody

STJ99014 200 µl
EUR 197
Description: Rabbit polyclonal to CNPY3.

Anti-CNPY3 antibody

STJ29256 100 µl
EUR 277
Description: This gene encodes a protein that binds members of the toll-like receptor protein family and functions as a chaperone to aid in folding and export of these proteins. Alternative splicing results in multiple transcript variants. Naturally occuring readthrough transcription occurs between this locus and the downstream GNMT (glycine N-methyltransferase) gene and is represented with GeneID:107080644.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CNPY3 cloning plasmid

CSB-CL874802HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 837
  • Sequence: atggattcaatgcctgagcccgcgtcccgctgtcttctgcttcttcccttgctgctgctgctgctgctgctgctgccggccccggagctgggcccgagccaggccggagctgaggagaacgactgggttcgcctgcccagcaaatgcgaagtgtgtaaatatgttgctgtggagct
  • Show more
Description: A cloning plasmid for the CNPY3 gene.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 98.00
  • EUR 133.00
  • EUR 523.00
  • 10 ul
  • 20 ul
  • 400 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

abx030445-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Canopy 3 Homolog (CNPY3) Antibody

abx231816-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit

E04P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit

E04P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protein canopy homolog 3(CNPY3) ELISA kit

E04P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CNPY3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF008767 96 Tests
EUR 689

Human CNPY3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CNPY3 protein (His tag)

80R-2698 100 ug
EUR 322
Description: Purified recombinant CNPY3 protein (His tag)

CNPY3 Recombinant Protein (Human)

RP007534 100 ug Ask for price

CNPY3 Recombinant Protein (Rat)

RP195659 100 ug Ask for price

CNPY3 Recombinant Protein (Mouse)

RP125105 100 ug Ask for price

CNPY3 ORF Vector (Human) (pORF)

ORF002512 1.0 ug DNA
EUR 95

Cnpy3 ORF Vector (Rat) (pORF)

ORF065221 1.0 ug DNA
EUR 506

Cnpy3 ORF Vector (Mouse) (pORF)

ORF041703 1.0 ug DNA
EUR 506

CNPY3 sgRNA CRISPR Lentivector set (Human)

K0477901 3 x 1.0 ug
EUR 339

Cnpy3 sgRNA CRISPR Lentivector set (Rat)

K6120301 3 x 1.0 ug
EUR 339

Cnpy3 sgRNA CRISPR Lentivector set (Mouse)

K4885701 3 x 1.0 ug
EUR 339

CNPY3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0477902 1.0 ug DNA
EUR 154

CNPY3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0477903 1.0 ug DNA
EUR 154

CNPY3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0477904 1.0 ug DNA
EUR 154

Human Canopy 3 Homolog (CNPY3) ELISA Kit

abx386611-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Cnpy3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6120302 1.0 ug DNA
EUR 154

Cnpy3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6120303 1.0 ug DNA
EUR 154

Cnpy3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6120304 1.0 ug DNA
EUR 154

Cnpy3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4885702 1.0 ug DNA
EUR 154

Cnpy3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4885703 1.0 ug DNA
EUR 154

Cnpy3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4885704 1.0 ug DNA
EUR 154

CNPY3 Protein Vector (Mouse) (pPB-C-His)

PV166810 500 ng
EUR 603

CNPY3 Protein Vector (Mouse) (pPB-N-His)

PV166811 500 ng
EUR 603

CNPY3 Protein Vector (Mouse) (pPM-C-HA)

PV166812 500 ng
EUR 603

CNPY3 Protein Vector (Mouse) (pPM-C-His)

PV166813 500 ng
EUR 603

Recombinant Human CNPY3 Protein, His, E.coli-1mg

QP11470-1mg 1mg
EUR 2757

Recombinant Human CNPY3 Protein, His, E.coli-20ug

QP11470-20ug 20ug
EUR 201

Recombinant Human CNPY3 Protein, His, E.coli-5ug

QP11470-5ug 5ug
EUR 155

CNPY3 Canopy 3 Homolog Human Recombinant Protein

PROTQ9BT09 Regular: 20ug
EUR 317
Description: CNPY3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 271 amino acids (31-278 a.a.) and having a molecular mass of 29.9kDa. CNPY3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

CNPY3 Protein Vector (Human) (pPB-C-His)

PV010045 500 ng
EUR 329

CNPY3 Protein Vector (Human) (pPB-N-His)

PV010046 500 ng
EUR 329

CNPY3 Protein Vector (Human) (pPM-C-HA)

PV010047 500 ng
EUR 329

CNPY3 Protein Vector (Human) (pPM-C-His)

PV010048 500 ng
EUR 329

CNPY3 Protein Vector (Rat) (pPB-C-His)

PV260882 500 ng
EUR 603

CNPY3 Protein Vector (Rat) (pPB-N-His)

PV260883 500 ng
EUR 603

CNPY3 Protein Vector (Rat) (pPM-C-HA)

PV260884 500 ng
EUR 603

CNPY3 Protein Vector (Rat) (pPM-C-His)

PV260885 500 ng
EUR 603

Cnpy3 3'UTR Luciferase Stable Cell Line

TU202567 1.0 ml Ask for price

Cnpy3 3'UTR GFP Stable Cell Line

TU154121 1.0 ml Ask for price

CNPY3 3'UTR Luciferase Stable Cell Line

TU004712 1.0 ml
EUR 1394

Cnpy3 3'UTR Luciferase Stable Cell Line

TU104121 1.0 ml Ask for price

CNPY3 3'UTR GFP Stable Cell Line

TU054712 1.0 ml
EUR 1394

Cnpy3 3'UTR GFP Stable Cell Line

TU252567 1.0 ml Ask for price

Rat Protein canopy homolog 3(CNPY3) ELISA kit

E02P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit

E02P0801-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protein canopy homolog 3(CNPY3) ELISA kit

E02P0801-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein canopy homolog 3(CNPY3) ELISA kit

E03P0801-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein canopy homolog 3(CNPY3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CNPY3 Rabbit Polyclonal Antibody

Back To Top