COASY Rabbit Polyclonal Antibody

COASY Rabbit Polyclonal Antibody

To Order:

COASY Polyclonal Antibody

ES9055-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COASY from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

COASY Rabbit pAb

A12179-100ul 100 ul
EUR 308

COASY Rabbit pAb

A12179-200ul 200 ul
EUR 459

COASY Rabbit pAb

A12179-20ul 20 ul
EUR 183

COASY Rabbit pAb

A12179-50ul 50 ul
EUR 223

COASY antibody

70R-16489 50 ul
EUR 435
Description: Rabbit polyclonal COASY antibody

COASY antibody

10R-6854 100 ul
EUR 691
Description: Mouse monoclonal COASY antibody

COASY antibody

10R-6855 100 ul
EUR 726
Description: Mouse monoclonal COASY antibody

COASY Antibody

45518-100ul 100ul
EUR 252

COASY Antibody

45518-50ul 50ul
EUR 187

COASY Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against COASY. Recognizes COASY from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

COASY Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COASY. Recognizes COASY from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:1000-1:5000, IF:1:50-1:200

COASY Antibody

DF8821 200ul
EUR 304
Description: COASY Antibody detects endogenous levels of total COASY.

COASY antibody

70R-51114 100 ul
EUR 244
Description: Purified Polyclonal COASY antibody

COASY Antibody

ABD13051 100 ug
EUR 438

COASY Antibody

ABD8821 100 ug
EUR 438

Polyclonal COASY Antibody - C-terminal region

APG02689G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COASY - C-terminal region. This antibody is tested and proven to work in the following applications:

COASY Conjugated Antibody

C45518 100ul
EUR 397

anti- COASY antibody

FNab01823 100µg
EUR 548.75
  • Immunogen: Coenzyme A synthase
  • Uniprot ID: Q13057
  • Gene ID: 80347
  • Research Area: Metabolism
Description: Antibody raised against COASY

Anti-COASY antibody

PAab01823 100 ug
EUR 386

Anti-COASY antibody

STJ114072 100 µl
EUR 277
Description: Coenzyme A (CoA) functions as a carrier of acetyl and acyl groups in cells and thus plays an important role in numerous synthetic and degradative metabolic pathways in all organisms. In eukaryotes, CoA and its derivatives are also involved in membrane trafficking and signal transduction. This gene encodes the bifunctional protein coenzyme A synthase (CoAsy) which carries out the last two steps in the biosynthesis of CoA from pantothenic acid (vitamin B5). The phosphopantetheine adenylyltransferase domain of this bifunctional protein catalyzes the conversion of 4'-phosphopantetheine into dephospho-coenzyme A (dpCoA) while its dephospho-CoA kinase domain completes the final step by phosphorylating dpCoA to form CoA. Mutations in this gene are associated with neurodegeneration with brain iron accumulation (NBIA). Alternative splicing results in multiple isoforms.

Anti-COASY antibody

STJ190213 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to COASY


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA21089 50 ul
EUR 363
Description: Mouse polyclonal to COASY


YF-PA21090 50 ug
EUR 363
Description: Mouse polyclonal to COASY


YF-PA21091 100 ul
EUR 403
Description: Rabbit polyclonal to COASY


YF-PA21092 100 ug
EUR 403
Description: Rabbit polyclonal to COASY


YF-PA26651 50 ul
EUR 334
Description: Mouse polyclonal to COASY

COASY Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COASY. Recognizes COASY from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

COASY Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COASY. Recognizes COASY from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

COASY Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COASY. Recognizes COASY from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

COASY Blocking Peptide

DF8821-BP 1mg
EUR 195

COASY Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Human COASY Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

COASY cloning plasmid

CSB-CL618754HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 678
  • Sequence: atgttggggaacctgcttcggcctccatatgaaaggccagagctccccacatgtctctatgtaattgggctgactggcatcagtggctctgggaagagctcaatagctcagcgactgaagggcctgggggcgtttgtcattgacagtgaccacctgggtcatcgggcctatgcccc
  • Show more
Description: A cloning plasmid for the COASY gene.

COASY cloning plasmid

CSB-CL618754HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 810
  • Sequence: atggccatcaaccgcttccgccttgagaatgacctggaggaacttgctttgtaccagatccagctgctgaaggacctcagacatacagagaatgaagaggacaaagtcagctcctccagcttccgccagcgaatgttggggaacctgcttcggcctccatatgaaaggccagagct
  • Show more
Description: A cloning plasmid for the COASY gene.

COASY cloning plasmid

CSB-CL618754HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1695
  • Sequence: atggccgtattccggtcgggtctcctggtgctgacgacgccgctggcctccctagcccctcgcctggcctccatcctgacctcggcggcccggctggtgaatcacacactctatgttcacctgcagccgggcatgagcctggagggcccggctcagccccagtacagccccgtgc
  • Show more
Description: A cloning plasmid for the COASY gene.

anti-COASY (1H6)

LF-MA10065 100 ug
EUR 363
Description: Mouse monoclonal to COASY

Anti-COASY (2A12)

YF-MA11679 100 ug
EUR 363
Description: Mouse monoclonal to COASY

Coenzyme A Synthase (COASY) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Coenzyme A Synthase (COASY) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coenzyme A Synthase (COASY) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Coenzyme A Synthase (COASY) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Coenzyme A Synthase (COASY) Antibody

abx145546-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Coenzyme A Synthase (COASY) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coenzyme A Synthase (COASY) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coenzyme A Synthase (COASY) Antibody

abx231823-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Rabbit Bifunctional coenzyme A synthase(COASY) ELISA kit

E04B0888-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bifunctional coenzyme A synthase(COASY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bifunctional coenzyme A synthase(COASY) ELISA kit

E04B0888-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bifunctional coenzyme A synthase(COASY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bifunctional coenzyme A synthase(COASY) ELISA kit

E04B0888-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bifunctional coenzyme A synthase(COASY) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Coenzyme A Synthase (COASY) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coenzyme A Synthase (COASY) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Coenzyme A Synthase (COASY) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF008772 96 Tests
EUR 689

Mouse COASY shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human COASY shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

COASY Recombinant Protein (Human)

RP007561 100 ug Ask for price

COASY Recombinant Protein (Human)

RP007564 100 ug Ask for price

COASY Recombinant Protein (Human)

RP007567 100 ug Ask for price

COASY Recombinant Protein (Rat)

RP195731 100 ug Ask for price

COASY Recombinant Protein (Mouse)

RP125204 100 ug Ask for price

Monoclonal COASY Antibody (monoclonal) (M01), Clone: 1H6

APG02687G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human COASY (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1H6. This antibody is applicable in WB, E

Monoclonal COASY Antibody (monoclonal) (M05), Clone: 2A12

APG02688G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human COASY (monoclonal) (M05). The antibodies are raised in mouse and are from clone 2A12. This antibody is applicable in WB and IHC, E

Coasy ORF Vector (Rat) (pORF)

ORF065245 1.0 ug DNA
EUR 506

COASY ORF Vector (Human) (pORF)

ORF002521 1.0 ug DNA
EUR 95

COASY ORF Vector (Human) (pORF)

ORF002522 1.0 ug DNA
EUR 95

COASY ORF Vector (Human) (pORF)

ORF002523 1.0 ug DNA
EUR 95

Coasy ORF Vector (Mouse) (pORF)

ORF041736 1.0 ug DNA
EUR 506

Recombinant Coenzyme A Synthase (COASY)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13057
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.3kDa
  • Isoelectric Point: 5.1
Description: Recombinant Human Coenzyme A Synthase expressed in: E.coli

Recombinant Coenzyme A Synthase (COASY)

  • EUR 395.68
  • EUR 209.00
  • EUR 1208.80
  • EUR 469.60
  • EUR 839.20
  • EUR 328.00
  • EUR 2872.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9DBL7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Coenzyme A Synthase expressed in: E.coli


PVT14104 2 ug
EUR 391

Mouse Coenzyme A Synthase (COASY) Protein

  • EUR 565.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 662.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

COASY sgRNA CRISPR Lentivector set (Human)

K0480201 3 x 1.0 ug
EUR 339

Coasy sgRNA CRISPR Lentivector set (Rat)

K7563601 3 x 1.0 ug
EUR 339

Coasy sgRNA CRISPR Lentivector set (Mouse)

K3445001 3 x 1.0 ug
EUR 339

Human Coenzyme A Synthase (COASY) ELISA Kit

abx386616-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Coenzyme A Synthase (COASY) ELISA Kit

abx388893-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

COASY sgRNA CRISPR Lentivector (Human) (Target 1)

K0480202 1.0 ug DNA
EUR 154

COASY sgRNA CRISPR Lentivector (Human) (Target 2)

K0480203 1.0 ug DNA
EUR 154

COASY sgRNA CRISPR Lentivector (Human) (Target 3)

K0480204 1.0 ug DNA
EUR 154

Coasy sgRNA CRISPR Lentivector (Rat) (Target 1)

K7563602 1.0 ug DNA
EUR 154

Coasy sgRNA CRISPR Lentivector (Rat) (Target 2)

K7563603 1.0 ug DNA
EUR 154

Coasy sgRNA CRISPR Lentivector (Rat) (Target 3)

K7563604 1.0 ug DNA
EUR 154

Coasy sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3445002 1.0 ug DNA
EUR 154

Coasy sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3445003 1.0 ug DNA
EUR 154

Coasy sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3445004 1.0 ug DNA
EUR 154

COASY Protein Vector (Mouse) (pPB-C-His)

PV166942 500 ng
EUR 603

COASY Protein Vector (Mouse) (pPB-N-His)

PV166943 500 ng
EUR 603

COASY Protein Vector (Mouse) (pPM-C-HA)

PV166944 500 ng
EUR 603

COASY Protein Vector (Mouse) (pPM-C-His)

PV166945 500 ng
EUR 603

COASY Protein Vector (Rat) (pPB-C-His)

PV260978 500 ng
EUR 603

COASY Protein Vector (Rat) (pPB-N-His)

PV260979 500 ng
EUR 603

COASY Protein Vector (Rat) (pPM-C-HA)

PV260980 500 ng
EUR 603

COASY Protein Vector (Rat) (pPM-C-His)

PV260981 500 ng
EUR 603

COASY Protein Vector (Human) (pPB-C-His)

PV010081 500 ng
EUR 329

COASY Protein Vector (Human) (pPB-N-His)

PV010082 500 ng
EUR 329

COASY Protein Vector (Human) (pPM-C-HA)

PV010083 500 ng
EUR 329

COASY Protein Vector (Human) (pPM-C-His)

PV010084 500 ng
EUR 329

COASY Protein Vector (Human) (pPB-C-His)

PV010085 500 ng
EUR 329

COASY Protein Vector (Human) (pPB-N-His)

PV010086 500 ng
EUR 329

COASY Protein Vector (Human) (pPM-C-HA)

PV010087 500 ng
EUR 329

COASY Protein Vector (Human) (pPM-C-His)

PV010088 500 ng
EUR 329

COASY Protein Vector (Human) (pPB-C-His)

PV010089 500 ng
EUR 329

COASY Protein Vector (Human) (pPB-N-His)

PV010090 500 ng
EUR 329

COASY Protein Vector (Human) (pPM-C-HA)

PV010091 500 ng
EUR 329

COASY Protein Vector (Human) (pPM-C-His)

PV010092 500 ng
EUR 329

Coasy 3'UTR Luciferase Stable Cell Line

TU202589 1.0 ml Ask for price

Coasy 3'UTR GFP Stable Cell Line

TU252589 1.0 ml Ask for price

COASY 3'UTR GFP Stable Cell Line

TU054736 1.0 ml
EUR 4617

COASY 3'UTR Luciferase Stable Cell Line

TU004736 1.0 ml
EUR 4617

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

COASY Rabbit Polyclonal Antibody

Back To Top