COL19A1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
 COL19A1 Polyclonal Antibody |
|
ES4759-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against COL19A1 from Human. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
|
COL19A1 Polyclonal Antibody |
|
ES8856-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against COL19A1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
COL19A1 Polyclonal Antibody |
|
ES8856-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against COL19A1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
|
COL19A1 Polyclonal Antibody |
|
ABP58227-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
- Applications tips:
|
|
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210 |
|
COL19A1 Polyclonal Antibody |
|
ABP58227-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
- Applications tips:
|
|
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210 |
|
COL19A1 Polyclonal Antibody |
|
ABP58227-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210
- Applications tips:
|
|
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL19A1 protein at amino acid sequence of 161-210 |
|
COL19A1 Polyclonal Antibody |
|
ABP53760-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
- Applications tips:
|
|
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470 |
|
COL19A1 Polyclonal Antibody |
|
ABP53760-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
- Applications tips:
|
|
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470 |
|
COL19A1 Polyclonal Antibody |
|
ABP53760-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470
- Applications tips:
|
|
Description: A polyclonal antibody for detection of COL19A1 from Human. This COL19A1 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COL19A1 at AA rangle: 390-470 |
|
COL19A1 Polyclonal Antibody |
|
46906-100ul |
SAB |
100ul |
EUR 252 |
|
COL19A1 Polyclonal Antibody |
|
46906-50ul |
SAB |
50ul |
EUR 187 |
 COL19A1 Polyclonal Conjugated Antibody |
|
C46906 |
SAB |
100ul |
EUR 397 |
 COL19A1 Antibody |
|
AF9044 |
Affbiotech |
200ul |
EUR 304 |
|
Description: COL19A1 Antibody detects endogenous levels of total COL19A1. |
|
COL19A1 Antibody |
|
44308-100ul |
SAB |
100ul |
EUR 252 |
|
COL19A1 Antibody |
|
44308-50ul |
SAB |
50ul |
EUR 187 |
|
COL19A1 Antibody |
|
1-CSB-PA007137 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
|
COL19A1 Antibody |
|
1-CSB-PA325870 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
|
COL19A1 Antibody |
|
CSB-PA213241- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500 |
|
COL19A1 Antibody |
|
CSB-PA213241-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
|
Description: A polyclonal antibody against COL19A1. Recognizes COL19A1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF;IHC:1:50-1:100, IF:1:100-1:500 |
 COL19A1 Conjugated Antibody |
|
C44308 |
SAB |
100ul |
EUR 397 |
 Anti-COL19A1 antibody |
|
STJ92382 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to COL19A1. |
|
Anti-COL19A1 antibody |
|
STJ99329 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to COL19A1. |
 COL19A1 siRNA |
|
20-abx912404 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
COL19A1 siRNA |
|
20-abx912405 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-COL19A1 |
|
YF-PA23489 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to COL19A1 |
 COL19A1 Blocking Peptide |
|
AF9044-BP |
Affbiotech |
1mg |
EUR 195 |
 COL19A1 cloning plasmid |
|
CSB-CL614819HU-10ug |
Cusabio |
10ug |
EUR 1252 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3429
- Sequence: ATGAGACTCACTGGCCCTTGGAAACTTTGGCTTTGGATGTCAATATTTCTGCTTCCTGCTTCCACTTCCGTGACCGTTAGGGACAAGACAGAAGAGTCATGCCCTATCCTGAGAATAGAGGGACATCAGCTGACATATGACAACATAAACAAACTTGAAGTTTCAGGTTTTGATC
- Show more
|
|
Description: A cloning plasmid for the COL19A1 gene. |
|
COL19A1 Blocking Peptide |
|
20-abx061072 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 Human COL19A1 shRNA Plasmid |
|
20-abx950922 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Mouse COL19A1 shRNA Plasmid |
|
20-abx969753 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 chian (COL19A1) ELISA kit) Rabbit Collagen Alpha 1(XIX) chian (COL19A1) ELISA kit |
|
E04C1898-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 1(XIX) chian (COL19A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rabbit Collagen Alpha 1(XIX) chian (COL19A1) ELISA kit |
|
E04C1898-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 1(XIX) chian (COL19A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
|
Rabbit Collagen Alpha 1(XIX) chian (COL19A1) ELISA kit |
|
E04C1898-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 1(XIX) chian (COL19A1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Chain (COL19A1) Antibody) Collagen Alpha-1(XIX) Chain (COL19A1) Antibody |
|
20-abx149451 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Collagen Alpha-1(XIX) Chain (COL19A1) Antibody |
|
20-abx133490 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
|
Collagen Alpha-1(XIX) Chain (COL19A1) Antibody |
|
abx030632-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
|
Collagen Alpha-1(XIX) Chain (COL19A1) Antibody |
|
abx030632-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
|
Collagen Alpha-1(XIX) Chain (COL19A1) Antibody |
|
20-abx013964 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
 (pORF)) Col19a1 ORF Vector (Mouse) (pORF) |
|
ORF041763 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) COL19A1 ORF Vector (Human) (pORF) |
|
ORF012738 |
ABM |
1.0 ug DNA |
EUR 354 |
 Antibody) Collagen Type XIX Alpha 1 Chain (COL19A1) Antibody |
|
20-abx324795 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Collagen Type XIX Alpha 1 Chain (COL19A1) Antibody |
|
20-abx324993 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
|
Collagen Type XIX Alpha 1 Chain (COL19A1) Antibody |
|
abx330322-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
) COL19A1 sgRNA CRISPR Lentivector set (Human) |
|
K0485401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Col19a1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3650901 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) COL19A1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0485402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) COL19A1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0485403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) COL19A1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0485404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Col19a1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3650902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Col19a1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3650903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Col19a1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3650904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) COL19A1 Protein Vector (Human) (pPB-C-His) |
|
PV050949 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) COL19A1 Protein Vector (Human) (pPB-N-His) |
|
PV050950 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) COL19A1 Protein Vector (Human) (pPM-C-HA) |
|
PV050951 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) COL19A1 Protein Vector (Human) (pPM-C-His) |
|
PV050952 |
ABM |
500 ng |
EUR 481 |
 (pPB-C-His)) COL19A1 Protein Vector (Mouse) (pPB-C-His) |
|
PV167050 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) COL19A1 Protein Vector (Mouse) (pPB-N-His) |
|
PV167051 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) COL19A1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV167052 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) COL19A1 Protein Vector (Mouse) (pPM-C-His) |
|
PV167053 |
ABM |
500 ng |
EUR 1065 |
 Col19a1 3'UTR Luciferase Stable Cell Line |
|
TU202611 |
ABM |
1.0 ml |
Ask for price |
 Col19a1 3'UTR GFP Stable Cell Line |
|
TU154169 |
ABM |
1.0 ml |
Ask for price |
 COL19A1 3'UTR Luciferase Stable Cell Line |
|
TU004792 |
ABM |
1.0 ml |
EUR 1521 |
|
Col19a1 3'UTR Luciferase Stable Cell Line |
|
TU104169 |
ABM |
1.0 ml |
Ask for price |
 COL19A1 3'UTR GFP Stable Cell Line |
|
TU054792 |
ABM |
1.0 ml |
EUR 1521 |
|
Col19a1 3'UTR GFP Stable Cell Line |
|
TU252611 |
ABM |
1.0 ml |
Ask for price |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
|
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
|
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG13 Rabbit Polyclonal Antibody |
|
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG14L Rabbit Polyclonal Antibody |
|
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
ATG14L Rabbit Polyclonal Antibody |
|
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NBR1 Rabbit Polyclonal Antibody |
|
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NBR1 Rabbit Polyclonal Antibody |
|
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
NBR1 Rabbit Polyclonal Antibody |
|
ES8579-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
WIPI2 Rabbit Polyclonal Antibody |
|
ES8580-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Gab1 Rabbit Polyclonal Antibody |
|
ES8582-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
|
Gab1 Rabbit Polyclonal Antibody |
|
ES8582-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ERK1 Rabbit Polyclonal Antibody |
|
ES8583-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
COL19A1 Rabbit Polyclonal Antibody
