COL8A2 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
COL8A2 Polyclonal Antibody |
ABP58228-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660
- Applications tips:
|
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660 |
COL8A2 Polyclonal Antibody |
ABP58228-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660
- Applications tips:
|
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660 |
COL8A2 Polyclonal Antibody |
ABP58228-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660
- Applications tips:
|
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660 |
COL8A2 Polyclonal Antibody |
ES8857-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against COL8A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
COL8A2 Polyclonal Antibody |
ES8857-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against COL8A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
COL8A2 Antibody |
43219-100ul |
SAB |
100ul |
EUR 252 |
COL8A2 Antibody |
1-CSB-PA068096 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
COL8A2 Antibody |
1-CSB-PA554584 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
COL8A2 Antibody |
1-CSB-PA295305 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
COL8A2 antibody |
70R-9965 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal COL8A2 antibody |
COL8A2 antibody |
70R-9966 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal COL8A2 antibody |
COL8A2 Conjugated Antibody |
C43219 |
SAB |
100ul |
EUR 397 |
Anti-COL8A2 antibody |
STJ99330 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to COL8A2. |
COL8A2 siRNA |
20-abx912461 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL8A2 siRNA |
20-abx912462 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL8A2 Blocking Peptide |
33R-3463 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COL8A2 antibody, catalog no. 70R-9965 |
COL8A2 Blocking Peptide |
33R-1023 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPBAP1 antibody, catalog no. 70R-8373 |
COL8A2 cloning plasmid |
CSB-CL005756HU-10ug |
Cusabio |
10ug |
EUR 469 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1284
- Sequence: ATGCTGGGGACTCTGACACCCCTGTCTTCGCTGCTGCTGCTGCTACTGGTGCTGGTGCTGGGGTGTGGGCCGCGGGCGTCCTCTGGTGGCGGGGCCGGTGGGGCGGCGGGCTATGCCCCAGTGAAGTACATCCAGCCCATGCAGAAAGGACCTGTGGGACCGCCCTTCCGTGAGG
- Show more
|
Description: A cloning plasmid for the COL8A2 gene. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse) |
4-PAD124Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp533~Pro698)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2) |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human) |
4-PAD124Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp537~Thr703)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2) |
Mouse COL8A2 shRNA Plasmid |
20-abx983586 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human COL8A2 shRNA Plasmid |
20-abx950910 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
COL8A2 Recombinant Protein (Human) |
RP038221 |
ABM |
100 ug |
Ask for price |
COL8A2 Recombinant Protein (Mouse) |
RP125396 |
ABM |
100 ug |
Ask for price |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), Biotinylated |
4-PAD124Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp537~Thr703)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Biotin. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), Cy3 |
4-PAD124Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp537~Thr703)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Cy3. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), FITC |
4-PAD124Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp537~Thr703)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with FITC. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), HRP |
4-PAD124Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp537~Thr703)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with HRP. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), PE |
4-PAD124Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp537~Thr703)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with PE. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), APC |
4-PAD124Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp533~Pro698)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), Biotinylated |
4-PAD124Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp533~Pro698)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Biotin. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), Cy3 |
4-PAD124Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp533~Pro698)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Cy3. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), FITC |
4-PAD124Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp533~Pro698)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with FITC. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), HRP |
4-PAD124Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp533~Pro698)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with HRP. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), PE |
4-PAD124Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp533~Pro698)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with PE. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), APC |
4-PAD124Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp537~Thr703)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC. |
Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit |
E04C1922-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit |
E04C1922-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit |
E04C1922-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAD124Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp533~Pro698)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC-Cy7. |
Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD124Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: COL8a2 (Asp537~Thr703)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC-Cy7. |
Collagen Type VIII Alpha 2 (COL8A2) Antibody |
abx026478-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Collagen Type VIII Alpha 2 (COL8A2) Antibody |
abx026478-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Collagen Type VIII Alpha 2 (COL8A2) Antibody |
20-abx212740 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Collagen Type VIII Alpha 2 (COL8A2) Antibody |
20-abx212741 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Collagen Type VIII Alpha 2 (COL8a2) Antibody |
20-abx102836 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Collagen Type VIII Alpha 2 (COL8a2) Antibody |
20-abx102837 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Collagen Type VIII Alpha 2 (COL8A2) Antibody |
20-abx149457 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Collagen Type VIII Alpha 2 (COL8A2) Antibody |
20-abx329804 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
COL8A2 ORF Vector (Human) (pORF) |
ORF012741 |
ABM |
1.0 ug DNA |
EUR 354 |
Col8a2 ORF Vector (Mouse) (pORF) |
ORF041800 |
ABM |
1.0 ug DNA |
EUR 506 |
COL8A2 ELISA Kit (Human) (OKCA01164) |
OKCA01164 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Macromolecular component of the subendothelium. Major component of the Descemet's membrane (basement membrane) of corneal endothelial cells. Also component of the endothelia of blood vessels. Necessary for migration and proliferation of vascular smooth muscle cells and thus, has a potential role in the maintenance of vessel wall integrity and structure, in particular in atherogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL |
Collagen Type VIII Alpha 2 (COL8a2) Antibody (Biotin) |
20-abx272547 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Collagen Type VIII Alpha 2 (COL8a2) Antibody (Biotin) |
20-abx273004 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1344.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
COL8A2 sgRNA CRISPR Lentivector set (Human) |
K0483901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Col8a2 sgRNA CRISPR Lentivector set (Mouse) |
K4173501 |
ABM |
3 x 1.0 ug |
EUR 339 |
COL8A2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0483902 |
ABM |
1.0 ug DNA |
EUR 154 |
COL8A2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0483903 |
ABM |
1.0 ug DNA |
EUR 154 |
COL8A2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0483904 |
ABM |
1.0 ug DNA |
EUR 154 |
Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4173502 |
ABM |
1.0 ug DNA |
EUR 154 |
Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4173503 |
ABM |
1.0 ug DNA |
EUR 154 |
Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4173504 |
ABM |
1.0 ug DNA |
EUR 154 |
COL8A2 Protein Vector (Mouse) (pPB-C-His) |
PV167198 |
ABM |
500 ng |
EUR 1065 |
COL8A2 Protein Vector (Mouse) (pPB-N-His) |
PV167199 |
ABM |
500 ng |
EUR 1065 |
COL8A2 Protein Vector (Mouse) (pPM-C-HA) |
PV167200 |
ABM |
500 ng |
EUR 1065 |
COL8A2 Protein Vector (Mouse) (pPM-C-His) |
PV167201 |
ABM |
500 ng |
EUR 1065 |
COL8A2 Protein Vector (Human) (pPB-C-His) |
PV050961 |
ABM |
500 ng |
EUR 481 |
COL8A2 Protein Vector (Human) (pPB-N-His) |
PV050962 |
ABM |
500 ng |
EUR 481 |
COL8A2 Protein Vector (Human) (pPM-C-HA) |
PV050963 |
ABM |
500 ng |
EUR 481 |
COL8A2 Protein Vector (Human) (pPM-C-His) |
PV050964 |
ABM |
500 ng |
EUR 481 |
Recombinant Collagen Type VIII Alpha 2 (COL8a2) |
4-RPD124Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P25067
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.4kDa
- Isoelectric Point: 6.4
|
Description: Recombinant Human Collagen Type VIII Alpha 2 expressed in: E.coli |
Recombinant Collagen Type VIII Alpha 2 (COL8a2) |
4-RPD124Mu01 |
Cloud-Clone |
-
EUR 492.45
-
EUR 235.00
-
EUR 1571.68
-
EUR 590.56
-
EUR 1081.12
-
EUR 392.00
-
EUR 3779.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P25318
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Collagen Type VIII Alpha 2 expressed in: E.coli |
Col8a2 3'UTR GFP Stable Cell Line |
TU154199 |
ABM |
1.0 ml |
Ask for price |
Col8a2 3'UTR Luciferase Stable Cell Line |
TU104199 |
ABM |
1.0 ml |
Ask for price |
Col8a2 3'UTR Luciferase Stable Cell Line |
TU202635 |
ABM |
1.0 ml |
Ask for price |
Col8a2 3'UTR GFP Stable Cell Line |
TU252635 |
ABM |
1.0 ml |
Ask for price |
COL8A2 3'UTR GFP Stable Cell Line |
TU054777 |
ABM |
1.0 ml |
EUR 1521 |
COL8A2 3'UTR Luciferase Stable Cell Line |
TU004777 |
ABM |
1.0 ml |
EUR 1521 |
Human Collagen Type VIII Alpha 2 (COL8a2) Protein |
20-abx066017 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Collagen Type VIII Alpha 2 (COL8a2) Protein |
20-abx066018 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
COL8A2 Rabbit Polyclonal Antibody