COL8A2 Rabbit Polyclonal Antibody

COL8A2 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

COL8A2 Polyclonal Antibody

ABP58228-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660
  • Applications tips:
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660

COL8A2 Polyclonal Antibody

ABP58228-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660
  • Applications tips:
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660

COL8A2 Polyclonal Antibody

ABP58228-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660
  • Applications tips:
Description: A polyclonal antibody for detection of COL8A2 from Human, Mouse, Rat. This COL8A2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human COL8A2 protein at amino acid sequence of 611-660

COL8A2 Polyclonal Antibody

ES8857-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against COL8A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

COL8A2 Polyclonal Antibody

ES8857-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COL8A2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

COL8A2 Antibody

43219-100ul 100ul
EUR 252

COL8A2 Antibody

1-CSB-PA068096
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

COL8A2 Antibody

1-CSB-PA554584
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

COL8A2 Antibody

1-CSB-PA295305
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against COL8A2. Recognizes COL8A2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

COL8A2 antibody

70R-9965 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal COL8A2 antibody

COL8A2 antibody

70R-9966 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal COL8A2 antibody

COL8A2 Conjugated Antibody

C43219 100ul
EUR 397

Anti-COL8A2 antibody

STJ99330 200 µl
EUR 197
Description: Rabbit polyclonal to COL8A2.

COL8A2 siRNA

20-abx912461
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COL8A2 siRNA

20-abx912462
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COL8A2 Blocking Peptide

33R-3463 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COL8A2 antibody, catalog no. 70R-9965

COL8A2 Blocking Peptide

33R-1023 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPBAP1 antibody, catalog no. 70R-8373

COL8A2 cloning plasmid

CSB-CL005756HU-10ug 10ug
EUR 469
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1284
  • Sequence: ATGCTGGGGACTCTGACACCCCTGTCTTCGCTGCTGCTGCTGCTACTGGTGCTGGTGCTGGGGTGTGGGCCGCGGGCGTCCTCTGGTGGCGGGGCCGGTGGGGCGGCGGGCTATGCCCCAGTGAAGTACATCCAGCCCATGCAGAAAGGACCTGTGGGACCGCCCTTCCGTGAGG
  • Show more
Description: A cloning plasmid for the COL8A2 gene.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse)

4-PAD124Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2)

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human)

4-PAD124Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2)

Mouse COL8A2 shRNA Plasmid

20-abx983586
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human COL8A2 shRNA Plasmid

20-abx950910
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

COL8A2 Recombinant Protein (Human)

RP038221 100 ug Ask for price

COL8A2 Recombinant Protein (Mouse)

RP125396 100 ug Ask for price

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), Biotinylated

4-PAD124Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Biotin.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), Cy3

4-PAD124Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Cy3.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), FITC

4-PAD124Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with FITC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), HRP

4-PAD124Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with HRP.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), PE

4-PAD124Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with PE.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), APC

4-PAD124Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), Biotinylated

4-PAD124Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Biotin.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), Cy3

4-PAD124Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with Cy3.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), FITC

4-PAD124Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with FITC.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), HRP

4-PAD124Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with HRP.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), PE

4-PAD124Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with PE.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), APC

4-PAD124Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC.

Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit

E04C1922-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit

E04C1922-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Collagen Alpha 2(VIII) chain (COL8A2) ELISA kit

E04C1922-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Collagen Alpha 2(VIII) chain (COL8A2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAD124Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp533~Pro698)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC-Cy7.

Collagen Type VIII Alpha 2 (COL8a2) Polyclonal Antibody (Human), APC-Cy7

4-PAD124Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: COL8a2 (Asp537~Thr703)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Collagen Type VIII Alpha 2 (COL8a2). This antibody is labeled with APC-Cy7.

Collagen Type VIII Alpha 2 (COL8A2) Antibody

abx026478-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody

abx026478-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody

20-abx212740
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody

20-abx212741
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8a2) Antibody

20-abx102836
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Collagen Type VIII Alpha 2 (COL8a2) Antibody

20-abx102837
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody

20-abx149457
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Collagen Type VIII Alpha 2 (COL8A2) Antibody

20-abx329804
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

COL8A2 ORF Vector (Human) (pORF)

ORF012741 1.0 ug DNA
EUR 354

Col8a2 ORF Vector (Mouse) (pORF)

ORF041800 1.0 ug DNA
EUR 506

pcDNA3.1-COL8A2-V5-His Plasmid

PVTB01199-2a 2 ug
EUR 356

COL8A2 ELISA Kit (Human) (OKCA01164)

OKCA01164 96 Wells
EUR 846
Description: Description of target: Macromolecular component of the subendothelium. Major component of the Descemet's membrane (basement membrane) of corneal endothelial cells. Also component of the endothelia of blood vessels. Necessary for migration and proliferation of vascular smooth muscle cells and thus, has a potential role in the maintenance of vessel wall integrity and structure, in particular in atherogenesis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.156 ng/mL

Collagen Type VIII Alpha 2 (COL8a2) Antibody (Biotin)

20-abx272547
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Collagen Type VIII Alpha 2 (COL8a2) Antibody (Biotin)

20-abx273004
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

COL8A2 sgRNA CRISPR Lentivector set (Human)

K0483901 3 x 1.0 ug
EUR 339

Col8a2 sgRNA CRISPR Lentivector set (Mouse)

K4173501 3 x 1.0 ug
EUR 339

COL8A2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0483902 1.0 ug DNA
EUR 154

COL8A2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0483903 1.0 ug DNA
EUR 154

COL8A2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0483904 1.0 ug DNA
EUR 154

Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4173502 1.0 ug DNA
EUR 154

Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4173503 1.0 ug DNA
EUR 154

Col8a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4173504 1.0 ug DNA
EUR 154

COL8A2 Protein Vector (Mouse) (pPB-C-His)

PV167198 500 ng
EUR 1065

COL8A2 Protein Vector (Mouse) (pPB-N-His)

PV167199 500 ng
EUR 1065

COL8A2 Protein Vector (Mouse) (pPM-C-HA)

PV167200 500 ng
EUR 1065

COL8A2 Protein Vector (Mouse) (pPM-C-His)

PV167201 500 ng
EUR 1065

COL8A2 Protein Vector (Human) (pPB-C-His)

PV050961 500 ng
EUR 481

COL8A2 Protein Vector (Human) (pPB-N-His)

PV050962 500 ng
EUR 481

COL8A2 Protein Vector (Human) (pPM-C-HA)

PV050963 500 ng
EUR 481

COL8A2 Protein Vector (Human) (pPM-C-His)

PV050964 500 ng
EUR 481

Recombinant Collagen Type VIII Alpha 2 (COL8a2)

4-RPD124Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P25067
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.4kDa
  • Isoelectric Point: 6.4
Description: Recombinant Human Collagen Type VIII Alpha 2 expressed in: E.coli

Recombinant Collagen Type VIII Alpha 2 (COL8a2)

4-RPD124Mu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P25318
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Collagen Type VIII Alpha 2 expressed in: E.coli

Col8a2 3'UTR GFP Stable Cell Line

TU154199 1.0 ml Ask for price

Col8a2 3'UTR Luciferase Stable Cell Line

TU104199 1.0 ml Ask for price

Col8a2 3'UTR Luciferase Stable Cell Line

TU202635 1.0 ml Ask for price

Col8a2 3'UTR GFP Stable Cell Line

TU252635 1.0 ml Ask for price

COL8A2 3'UTR GFP Stable Cell Line

TU054777 1.0 ml
EUR 1521

COL8A2 3'UTR Luciferase Stable Cell Line

TU004777 1.0 ml
EUR 1521

Human Collagen Type VIII Alpha 2 (COL8a2) Protein

20-abx066017
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Collagen Type VIII Alpha 2 (COL8a2) Protein

20-abx066018
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

NM23A Rabbit Polyclonal Antibody

ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

ATM Rabbit Polyclonal Antibody

ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

ATM Rabbit Polyclonal Antibody

ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

COL8A2 Rabbit Polyclonal Antibody

Back To Top