DAG1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
DAG1 Polyclonal Antibody |
ABP58328-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910
- Applications tips:
|
Description: A polyclonal antibody for detection of DAG1 from Human, Mouse. This DAG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910 |
DAG1 Polyclonal Antibody |
ES8965-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DAG1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DAG1 Polyclonal Antibody |
ES8965-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DAG1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DAG1 Rabbit pAb |
A10076-100ul |
Abclonal |
100 ul |
EUR 308 |
DAG1 Rabbit pAb |
A10076-200ul |
Abclonal |
200 ul |
EUR 459 |
DAG1 Rabbit pAb |
A10076-20ul |
Abclonal |
20 ul |
EUR 183 |
DAG1 Rabbit pAb |
A10076-50ul |
Abclonal |
50 ul |
EUR 223 |
DAG1 Polyclonal Conjugated Antibody |
C27283 |
SAB |
100ul |
EUR 397 |
Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
DLR-DAG1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dystrophin Associated Glycoprotein 1 (DAG1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
DLR-DAG1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Dystrophin Associated Glycoprotein 1 (DAG1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
DLR-DAG1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dystrophin Associated Glycoprotein 1 (DAG1) in samples from tissue homogenates or other biological fluids. |
Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
DLR-DAG1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dystrophin Associated Glycoprotein 1 (DAG1) in samples from tissue homogenates or other biological fluids. |
Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
RDR-DAG1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
RDR-DAG1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
RDR-DAG1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
RDR-DAG1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
RD-DAG1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
RD-DAG1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
RD-DAG1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit |
RD-DAG1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
DAG1 antibody |
70R-16733 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DAG1 antibody |
DAG1 Antibody |
1-CSB-PA613486NA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
DAG1 Antibody |
DF10349 |
Affbiotech |
200ul |
EUR 304 |
Description: DAG1 Antibody detects endogenous levels of DAG1. |
DAG1 Antibody |
1-CSB-PA006488GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
DAG1 antibody |
70R-6688 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal DAG1 antibody |
Dag1 antibody |
70R-8652 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Dag1 antibody |
Polyclonal DAG1 Antibody (C-term) |
AMRa00050G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DAG1 (C-term). This antibody is tested and proven to work in the following applications: |
Polyclonal DAG1 Antibody (internal region) |
AMRa00051G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DAG1 (internal region). This antibody is tested and proven to work in the following applications: |
Polyclonal DAG1 / Dystroglycan Antibody (Internal) |
AMM05825G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DAG1 / Dystroglycan (Internal). This antibody is tested and proven to work in the following applications: |
DAG1 (Phospho-Tyr892) Polyclonal Conjugated Antibody |
C12556 |
SAB |
100ul |
EUR 397 |
Polyclonal Dag1 antibody - C-terminal region |
AMM05827G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dag1 - C-terminal region. This antibody is tested and proven to work in the following applications: |
Rabbit Dystroglycan(DAG1) ELISA kit |
E04D0279-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Dystroglycan(DAG1) ELISA kit |
E04D0279-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Dystroglycan(DAG1) ELISA kit |
E04D0279-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
DAG1 (pY892) Antibody |
abx149722-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Anti-DAG1 antibody |
STJ112116 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteolytic processing to generate alpha and beta subunits. Certain mutations in this gene are known to cause distinct forms of muscular dystrophy. Alternative splicing results in multiple transcript variants, all encoding the same protein. |
Anti-DAG1 antibody |
STJ190123 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to DAG1 |
Rabbit Dystroglycan 1 (DAG1) ELISA Kit |
abx362941-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
ELISA kit for Rabbit Dystroglycan (DAG1) |
KTE90114-48T |
Abbkine |
48T |
EUR 354 |
- Dystroglycan (DAG1) encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteoly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Dystroglycan (DAG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Dystroglycan (DAG1) |
KTE90114-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- Dystroglycan (DAG1) encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteoly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Dystroglycan (DAG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Dystroglycan (DAG1) |
KTE90114-96T |
Abbkine |
96T |
EUR 572 |
- Dystroglycan (DAG1) encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteoly
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Dystroglycan (DAG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
DAG1 siRNA |
20-abx913543 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DAG1 siRNA |
20-abx913544 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DAG1 (Phospho-Tyr892) Antibody |
12556-100ul |
SAB |
100ul |
EUR 252 |
DAG1 (Phospho-Tyr892) Antibody |
12556-50ul |
SAB |
50ul |
EUR 187 |
DAG1 Antibody, HRP conjugated |
1-CSB-PA613486NB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DAG1 Antibody, FITC conjugated |
1-CSB-PA613486NC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DAG1 Antibody, Biotin conjugated |
1-CSB-PA613486ND01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Dystroglycan 1 (DAG1) Antibody |
20-abx112212 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dystroglycan 1 (DAG1) Antibody |
20-abx135994 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dystroglycan 1 (DAG1) Antibody |
abx432586-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Phospho-DAG1 (Tyr892) Antibody |
AF8216 |
Affbiotech |
200ul |
EUR 376 |
Description: DAG1 (Phospho-Tyr892) Antibody detects endogenous levels of DAG1 only when phosphorylated at Tyr892. |
Dystrophin Associated Glycoprotein 1 (DAG1) Polyclonal Antibody (Mouse) |
4-PAC448Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAG1 (His28~Pro406)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dystrophin Associated Glycoprotein 1 (DAG1) |
DAG1 Blocking Peptide |
33R-1265 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POMT2 antibody, catalog no. 70R-6997 |
Dag1 Blocking Peptide |
33R-7277 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Dag1 antibody, catalog no. 70R-8652 |
DAG1 Blocking Peptide |
DF10349-BP |
Affbiotech |
1mg |
EUR 195 |
DAG1 cloning plasmid |
CSB-CL613486HU-10ug |
Cusabio |
10ug |
EUR 863 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2688
- Sequence: atgaggatgtctgtgggcctctcgctgctgctgcccctctgggggaggacctttctcctcctgctctctgtggttatggctcagtcccactggcccagtgaaccctcagaggctgtcagggactgggaaaaccagcttgaggcatccatgcactcagtgctctcagacctccacg
- Show more
|
Description: A cloning plasmid for the DAG1 gene. |
Dystrophin Associated Glycoprotein 1 (DAG1) Polyclonal Antibody (Mouse), APC |
4-PAC448Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DAG1 (His28~Pro406)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Dystrophin Associated Glycoprotein 1 (DAG1). This antibody is labeled with APC. |
DAG1 Rabbit Polyclonal Antibody