DAG1 Rabbit Polyclonal Antibody

DAG1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

DAG1 Polyclonal Antibody

ABP58328-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910
  • Applications tips:
Description: A polyclonal antibody for detection of DAG1 from Human, Mouse. This DAG1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DAG1 protein at amino acid sequence of 830-910

DAG1 Polyclonal Antibody

27283-100ul 100ul
EUR 252

DAG1 Polyclonal Antibody

27283-50ul 50ul
EUR 187

DAG1 Rabbit pAb

A10076-100ul 100 ul
EUR 308

DAG1 Rabbit pAb

A10076-200ul 200 ul
EUR 459

DAG1 Rabbit pAb

A10076-20ul 20 ul
EUR 183

DAG1 Rabbit pAb

A10076-50ul 50 ul
EUR 223

DAG1 Polyclonal Conjugated Antibody

C27283 100ul
EUR 397

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

DLR-DAG1-Hu-48T 48T
EUR 517
  • Should the Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dystrophin Associated Glycoprotein 1 (DAG1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

DLR-DAG1-Hu-96T 96T
EUR 673
  • Should the Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dystrophin Associated Glycoprotein 1 (DAG1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

DLR-DAG1-Mu-48T 48T
EUR 527
  • Should the Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dystrophin Associated Glycoprotein 1 (DAG1) in samples from tissue homogenates or other biological fluids.

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

DLR-DAG1-Mu-96T 96T
EUR 688
  • Should the Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dystrophin Associated Glycoprotein 1 (DAG1) in samples from tissue homogenates or other biological fluids.

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RDR-DAG1-Hu-48Tests 48 Tests
EUR 544

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RDR-DAG1-Hu-96Tests 96 Tests
EUR 756

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RDR-DAG1-Mu-48Tests 48 Tests
EUR 557

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RDR-DAG1-Mu-96Tests 96 Tests
EUR 774

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RD-DAG1-Hu-48Tests 48 Tests
EUR 521

Human Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RD-DAG1-Hu-96Tests 96 Tests
EUR 723

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RD-DAG1-Mu-48Tests 48 Tests
EUR 533

Mouse Dystrophin Associated Glycoprotein 1 (DAG1) ELISA Kit

RD-DAG1-Mu-96Tests 96 Tests
EUR 740

DAG1 antibody

70R-6688 50 ug
EUR 467
Description: Rabbit polyclonal DAG1 antibody

Dag1 antibody

70R-8652 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Dag1 antibody

DAG1 antibody

70R-16733 50 ul
EUR 435
Description: Rabbit polyclonal DAG1 antibody

DAG1 Antibody

DF10349 200ul
EUR 304
Description: DAG1 Antibody detects endogenous levels of DAG1.

DAG1 Antibody

1-CSB-PA006488GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

DAG1 Antibody

1-CSB-PA613486NA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Polyclonal DAG1 Antibody (C-term)

AMRa00050G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DAG1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal DAG1 Antibody (internal region)

AMRa00051G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DAG1 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal DAG1 / Dystroglycan Antibody (Internal)

AMM05825G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DAG1 / Dystroglycan (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal Dag1 antibody - C-terminal region

AMM05827G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dag1 - C-terminal region. This antibody is tested and proven to work in the following applications:

DAG1 (Phospho-Tyr892) Polyclonal Conjugated Antibody

C12556 100ul
EUR 397

Rabbit Dystroglycan(DAG1) ELISA kit

E04D0279-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dystroglycan(DAG1) ELISA kit

E04D0279-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dystroglycan(DAG1) ELISA kit

E04D0279-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Dystroglycan(DAG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Dystroglycan, DAG1 ELISA KIT

ELI-47400Ra 96 Tests
EUR 928

DAG1 (pY892) Antibody

abx149722-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Anti-DAG1 antibody

STJ72268 100 µg
EUR 359

Anti-DAG1 antibody

STJ112116 100 µl
EUR 277
Description: This gene encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteolytic processing to generate alpha and beta subunits. Certain mutations in this gene are known to cause distinct forms of muscular dystrophy. Alternative splicing results in multiple transcript variants, all encoding the same protein.

Anti-DAG1 antibody

STJ190123 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DAG1

Rabbit Dystroglycan 1 (DAG1) ELISA Kit

abx362941-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Rabbit Dystroglycan (DAG1)

KTE90114-48T 48T
EUR 354
  • Dystroglycan (DAG1) encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteoly
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Dystroglycan (DAG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Dystroglycan (DAG1)

KTE90114-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Dystroglycan (DAG1) encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteoly
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Dystroglycan (DAG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Dystroglycan (DAG1)

KTE90114-96T 96T
EUR 572
  • Dystroglycan (DAG1) encodes dystroglycan, a central component of dystrophin-glycoprotein complex that links the extracellular matrix and the cytoskeleton in the skeletal muscle. The encoded preproprotein undergoes O- and N-glycosylation, and proteoly
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Dystroglycan (DAG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DAG1 siRNA

20-abx913543
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DAG1 siRNA

20-abx913544
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-DAG1 (Tyr892) Antibody

AF8216 200ul
EUR 376
Description: DAG1 (Phospho-Tyr892) Antibody detects endogenous levels of DAG1 only when phosphorylated at Tyr892.

Dystroglycan 1 (DAG1) Antibody

20-abx112212
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystroglycan 1 (DAG1) Antibody

20-abx135994
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

DAG1 (Phospho- Tyr892) Antibody

ABF8216 100 ug
EUR 438

Dystroglycan 1 (DAG1) Antibody

abx432586-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

DAG1 (Phospho-Tyr892) Antibody

12556-100ul 100ul
EUR 252

DAG1 (Phospho-Tyr892) Antibody

12556-50ul 50ul
EUR 187

DAG1 Antibody, HRP conjugated

1-CSB-PA613486NB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DAG1 Antibody, FITC conjugated

1-CSB-PA613486NC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DAG1 Antibody, Biotin conjugated

1-CSB-PA613486ND01HU
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DAG1. Recognizes DAG1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Dystrophin Associated Glycoprotein 1 (DAG1) Polyclonal Antibody (Mouse)

4-PAC448Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAG1 (His28~Pro406)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin Associated Glycoprotein 1 (DAG1)

DAG1 cloning plasmid

CSB-CL613486HU-10ug 10ug
EUR 863
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2688
  • Sequence: atgaggatgtctgtgggcctctcgctgctgctgcccctctgggggaggacctttctcctcctgctctctgtggttatggctcagtcccactggcccagtgaaccctcagaggctgtcagggactgggaaaaccagcttgaggcatccatgcactcagtgctctcagacctccacg
  • Show more
Description: A cloning plasmid for the DAG1 gene.

DAG1 Blocking Peptide

33R-1265 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of POMT2 antibody, catalog no. 70R-6997

Dag1 Blocking Peptide

33R-7277 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Dag1 antibody, catalog no. 70R-8652

DAG1 Blocking Peptide

DF10349-BP 1mg
EUR 195

Dystrophin Associated Glycoprotein 1 (DAG1) Polyclonal Antibody (Mouse), APC

4-PAC448Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DAG1 (His28~Pro406)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin Associated Glycoprotein 1 (DAG1). This antibody is labeled with APC.

DAG1 Rabbit Polyclonal Antibody

Back To Top