DMD Rabbit Polyclonal Antibody

DMD Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

Human Dystrophin (DMD) ELISA Kit
DLR-DMD-Hu-96T 96T
EUR 647
  • Should the Human Dystrophin (DMD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Dystrophin (DMD) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Dystrophin (DMD) ELISA Kit
DLR-DMD-Mu-48T 48T
EUR 508
  • Should the Mouse Dystrophin (DMD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dystrophin (DMD) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Dystrophin (DMD) ELISA Kit
DLR-DMD-Mu-96T 96T
EUR 661
  • Should the Mouse Dystrophin (DMD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Dystrophin (DMD) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Dystrophin (DMD) ELISA Kit
RDR-DMD-Hu-48Tests 48 Tests
EUR 522
Human Dystrophin (DMD) ELISA Kit
RDR-DMD-Hu-96Tests 96 Tests
EUR 724
Mouse Dystrophin (DMD) ELISA Kit
RDR-DMD-Mu-48Tests 48 Tests
EUR 534
Mouse Dystrophin (DMD) ELISA Kit
RDR-DMD-Mu-96Tests 96 Tests
EUR 742
Human Dystrophin (DMD) ELISA Kit
RD-DMD-Hu-48Tests 48 Tests
EUR 500
Human Dystrophin (DMD) ELISA Kit
RD-DMD-Hu-96Tests 96 Tests
EUR 692
Mouse Dystrophin (DMD) ELISA Kit
RD-DMD-Mu-48Tests 48 Tests
EUR 511
Mouse Dystrophin (DMD) ELISA Kit
RD-DMD-Mu-96Tests 96 Tests
EUR 709
DMD Polyclonal Antibody
ABP58391-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DMD protein
  • Applications tips:
Description: A polyclonal antibody for detection of DMD from Human, Mouse, Rat. This DMD antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMD protein
DMD Polyclonal Antibody
ABP58391-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DMD protein
  • Applications tips:
Description: A polyclonal antibody for detection of DMD from Human, Mouse, Rat. This DMD antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMD protein
DMD Polyclonal Antibody
ABP58391-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DMD protein
  • Applications tips:
Description: A polyclonal antibody for detection of DMD from Human, Mouse, Rat. This DMD antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DMD protein
DMD Polyclonal Antibody
ES9017-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DMD from Human/Mouse/Rat. This antibody is tested and validated for IHC
DMD Polyclonal Antibody
ES9017-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DMD from Human/Mouse/Rat. This antibody is tested and validated for IHC
DMD Rabbit pAb
A1411-100ul 100 ul
EUR 308
DMD Rabbit pAb
A1411-200ul 200 ul
EUR 459
DMD Rabbit pAb
A1411-20ul 20 ul
EUR 183
DMD Rabbit pAb
A1411-50ul 50 ul
EUR 223
Polyclonal DMD / Dystrophin Antibody
APR11762G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DMD / Dystrophin . This antibody is tested and proven to work in the following applications:
Rabbit DMD ELISA Kit
ERTD0036 96Tests
EUR 521
Dystrophin (DMD) Polyclonal Antibody (Human)
4-PAB503Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD)
Dystrophin (DMD) Polyclonal Antibody (Mouse)
4-PAB503Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD)
DMD antibody
70R-16862 50 ul
EUR 435
Description: Rabbit polyclonal DMD antibody
DMD Antibody
36428-100ul 100ul
EUR 252
DMD Antibody
1-CSB-PA503789
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DMD. Recognizes DMD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
DMD Antibody
1-CSB-PA006963GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
DMD Antibody
1-CSB-PA006963LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500
Dystrophin (DMD) Polyclonal Antibody (Human), APC
4-PAB503Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with APC.
Dystrophin (DMD) Polyclonal Antibody (Human), Biotinylated
4-PAB503Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with Biotin.
Dystrophin (DMD) Polyclonal Antibody (Human), Cy3
4-PAB503Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with Cy3.
Dystrophin (DMD) Polyclonal Antibody (Human), FITC
4-PAB503Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with FITC.
Dystrophin (DMD) Polyclonal Antibody (Human), HRP
4-PAB503Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with HRP.
Dystrophin (DMD) Polyclonal Antibody (Human), PE
4-PAB503Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with PE.
Dystrophin (DMD) Polyclonal Antibody (Mouse), APC
4-PAB503Mu01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with APC.
Dystrophin (DMD) Polyclonal Antibody (Mouse), Biotinylated
4-PAB503Mu01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with Biotin.
Dystrophin (DMD) Polyclonal Antibody (Mouse), Cy3
4-PAB503Mu01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with Cy3.
Dystrophin (DMD) Polyclonal Antibody (Mouse), FITC
4-PAB503Mu01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with FITC.
Dystrophin (DMD) Polyclonal Antibody (Mouse), HRP
4-PAB503Mu01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with HRP.
Dystrophin (DMD) Polyclonal Antibody (Mouse), PE
4-PAB503Mu01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with PE.
Rabbit Dystrophin (DMD) ELISA Kit
abx355333-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Dystrophin (DMD) Antibody
20-abx176215
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Dystrophin (DMD) Antibody
20-abx211560
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dystrophin (DMD) Antibody
20-abx100315
  • EUR 328.00
  • EUR 133.00
  • EUR 787.00
  • EUR 411.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dystrophin (DMD) Antibody
20-abx100316
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Dystrophin (DMD) Antibody
20-abx112214
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dystrophin (DMD) Antibody
20-abx149852
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dystrophin (DMD) Antibody
20-abx172180
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.
DMD Conjugated Antibody
C36428 100ul
EUR 397
Dystrophin (DMD) Antibody
abx232423-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Dystrophin (DMD) Antibody
20-abx001224
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
anti- DMD antibody
FNab02423 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • IHC: 1:50-1:500
  • IF: 1:20-1:200
  • Immunogen: dystrophin
  • Uniprot ID: P11532
  • Gene ID: 1756
  • Research Area: Neuroscience, Stem Cells, Signal Transduction
Description: Antibody raised against DMD
Anti-DMD antibody
PAab02423 100 ug
EUR 355
Anti-DMD antibody
STJ23394 100 µl
EUR 277
Description: This gene spans a genomic range of greater than 2 Mb and encodes a large protein containing an N-terminal actin-binding domain and multiple spectrin repeats. The encoded protein forms a component of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extracellular matrix. Deletions, duplications, and point mutations at this gene locus may cause Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or cardiomyopathy. Alternative promoter usage and alternative splicing result in numerous distinct transcript variants and protein isoforms for this gene.
Anti-DMD antibody
STJ190175 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DMD
Dystrophin (DMD) Polyclonal Antibody (Human), APC-Cy7
4-PAB503Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ala3048~Ser3328)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrophin (DMD). This antibody is labeled with APC-Cy7.
Dystrophin (DMD) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB503Mu01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMD (Ser3059~Ile3314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dystrophin (DMD). This antibody is labeled with APC-Cy7.
DMD siRNA
20-abx914266
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DMD siRNA
20-abx914267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DMD Antibody, HRP conjugated
1-CSB-PA006963LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DMD Antibody, FITC conjugated
1-CSB-PA006963LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DMD Antibody, Biotin conjugated
1-CSB-PA006963LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMD. Recognizes DMD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Anti-Dystrophin/DMD Antibody
PB9276 100ug/vial
EUR 334
DMD cloning plasmid
CSB-CL006963HU-10ug 10ug
EUR 644
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1908
  • Sequence: atgagggaacagctcaaaggccacgagactcaaacaacttgctgggaccatcccaaaatgacagagctctaccagtctttagctgacctgaataatgtcagattctcagcttataggactgccatgaaactccgaagactgcagaaggccctttgcttggatctcttgagcctgt
  • Show more
Description: A cloning plasmid for the DMD gene.
Recombinant Dystrophin (DMD)
4-RPB503Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11532
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dystrophin expressed in: E.coli
Recombinant Dystrophin (DMD)
4-RPB503Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P11531
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Dystrophin expressed in: E.coli
Human Dystrophin (DMD) Protein
20-abx066369
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Mouse Dystrophin (DMD) Protein
20-abx066370
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Human DMD ELISA Kit
EHD0036 96Tests
EUR 521
Human DMD ELISA Kit
ELA-E1503h 96 Tests
EUR 824
Goat DMD ELISA Kit
EGTD0036 96Tests
EUR 521
Bovine DMD ELISA Kit
EBD0036 96Tests
EUR 521
Canine DMD ELISA Kit
ECD0036 96Tests
EUR 521
Chicken DMD ELISA Kit
ECKD0036 96Tests
EUR 521
Anserini DMD ELISA Kit
EAD0036 96Tests
EUR 521
DMD ELISA KIT|Human
EF005868 96 Tests
EUR 689
Mouse DMD shRNA Plasmid
20-abx970021
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human DMD shRNA Plasmid
20-abx951219
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse DMD ELISA Kit
EMD0036 96Tests
EUR 521
Rat DMD ELISA Kit
ERD0036 96Tests
EUR 521
Sheep DMD ELISA Kit
ESD0036 96Tests
EUR 521
Monkey DMD ELISA Kit
EMKD0036 96Tests
EUR 521
Porcine DMD ELISA Kit
EPD0036 96Tests
EUR 521
Dog DMD/ Dystrophin ELISA Kit
E0031Do 1 Kit
EUR 717
Rat Dmd/ Dystrophin ELISA Kit
E0300Ra 1 Kit
EUR 571
Mouse Dmd/ Dystrophin ELISA Kit
E0409Mo 1 Kit
EUR 571
Human Dystrophin (DMD) CLIA Kit
abx196619-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Mouse Dystrophin (DMD) CLIA Kit
abx196919-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Rat Dystrophin (DMD) CLIA Kit
abx196920-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Human Dystrophin (DMD) ELISA Kit
abx051660-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Dystrophin (DMD) ELISA Kit
20-abx153933
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Dystrophin (DMD) ELISA Kit
20-abx151364
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Dystrophin (DMD) ELISA Kit
abx255323-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Dystrophin (DMD) ELISA Kit
abx256876-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Dystrophin (DMD) ELISA Kit
abx251028-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Guinea Pig DMD ELISA Kit
EGD0036 96Tests
EUR 521
Human DMD/ Dystrophin ELISA Kit
E0707Hu 1 Kit
EUR 571
Human DMD(Dystrophin) ELISA Kit
EH1726 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P11532
  • Alias: DMD/Dystrophin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Porcine Dystrophin, DMD ELISA KIT
ELI-04960p 96 Tests
EUR 928
Chicken Dystrophin, DMD ELISA KIT
ELI-04961c 96 Tests
EUR 928
Human Dystrophin, DMD ELISA KIT
ELI-04962h 96 Tests
EUR 824
Mouse Dystrophin, Dmd ELISA KIT
ELI-04963m 96 Tests
EUR 865
Rat Dystrophin, Dmd ELISA KIT
ELI-04964r 96 Tests
EUR 886
Canine Dystrophin, DMD ELISA KIT
ELI-04965d 96 Tests
EUR 928
Chicken Dystrophin (DMD) ELISA Kit
abx354772-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Monkey Dystrophin (DMD) ELISA Kit
abx354916-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Pig Dystrophin (DMD) ELISA Kit
abx355075-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.
Sheep Dystrophin (DMD) ELISA Kit
abx355367-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Dog Dystrophin (DMD) ELISA Kit
abx355448-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.
Human Dystrophin (DMD) ELISA Kit
abx570218-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Mouse Dystrophin (DMD) ELISA Kit
abx572510-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Dog Dystrophin (DMD) ELISA Kit
abx517496-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

DMD Rabbit Polyclonal Antibody

Back To Top