DMP1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
 DMP1 Polyclonal Antibody |
|
ES9058-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against DMP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 DMP1 Rabbit pAb |
|
A11076-100ul |
Abclonal |
100 ul |
EUR 308 |
DMP1 Rabbit pAb |
|
A11076-200ul |
Abclonal |
200 ul |
EUR 459 |
DMP1 Rabbit pAb |
|
A11076-20ul |
Abclonal |
20 ul |
EUR 183 |
DMP1 Rabbit pAb |
|
A11076-50ul |
Abclonal |
50 ul |
EUR 223 |
DMP1 Rabbit pAb |
|
A16832-100ul |
Abclonal |
100 ul |
EUR 308 |
DMP1 Rabbit pAb |
|
A16832-200ul |
Abclonal |
200 ul |
EUR 459 |
DMP1 Rabbit pAb |
|
A16832-20ul |
Abclonal |
20 ul |
EUR 183 |
DMP1 Rabbit pAb |
|
A16832-50ul |
Abclonal |
50 ul |
EUR 223 |
 DMP1 antibody |
|
70R-12137 |
Fitzgerald |
100 ug |
EUR 460 |
|
Description: Rabbit polyclonal DMP1 antibody |
DMP1 antibody |
|
38779-100ul |
SAB |
100ul |
EUR 252 |
 DMP1 Antibody |
|
DF8825 |
Affbiotech |
200ul |
EUR 304 |
|
Description: DMP1 Antibody detects endogenous levels of total DMP1. |
DMP1 Antibody |
|
1-CSB-PA006967DSR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against DMP1. Recognizes DMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
) Polyclonal DMP1 Antibody (N-term) |
|
APR15749G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DMP1 (N-term). This antibody is tested and proven to work in the following applications: |
 Polyclonal Goat Anti-DMP1 Antibody |
|
APR16266G |
Leading Biology |
0.1 mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-DMP1 . This antibody is tested and proven to work in the following applications: |
 DMP1 Conjugated Antibody |
|
C38779 |
SAB |
100ul |
EUR 397 |
 Anti-DMP1 antibody |
|
STJ113700 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. |
Anti-DMP1 antibody |
|
STJ190216 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to DMP1 |
 DMP1 siRNA |
|
20-abx914272 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DMP1 siRNA |
|
20-abx914273 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 DMP1 Blocking Peptide |
|
33R-10953 |
Fitzgerald |
50 ug |
EUR 191 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DMP1 antibody, catalog no. 70R-12137 |
DMP1 Blocking Peptide |
|
3844BP-50 |
Biovision |
|
EUR 153 |
DMP1 Blocking Peptide |
|
DF8825-BP |
Affbiotech |
1mg |
EUR 195 |
 DMP1 cloning plasmid |
|
CSB-CL006967HU-10ug |
Cusabio |
10ug |
EUR 541 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1542
- Sequence: atgaagatcagcatcctgctcatgttcctttggggattatcctgtgctctcccagtaaccaggtatcaaaataatgaatctgaggattctgaagaatggaagggtcatttggctcaggcaccaacaccacccttggagagcagtgagtcatcagaaggcagtaaagttagctcag
- Show more
|
|
Description: A cloning plasmid for the DMP1 gene. |
) Anti-DMP1 (1D4) |
|
YF-MA12712 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to DMP1 |
) Dog Uncharacterized protein (DMP1) |
|
1-CSB-EP2043DO |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 63.5 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Dog Uncharacterized protein(DMP1) expressed in E.coli |
 Mouse DMP1 shRNA Plasmid |
|
20-abx970022 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human DMP1 shRNA Plasmid |
|
20-abx951221 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) DMP1 Recombinant Protein (Human) |
|
RP038551 |
ABM |
100 ug |
Ask for price |
) DMP1 Recombinant Protein (Rat) |
|
RP198224 |
ABM |
100 ug |
Ask for price |
) DMP1 Recombinant Protein (Mouse) |
|
RP129329 |
ABM |
100 ug |
Ask for price |
 Antibody) Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
|
20-abx004775 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
|
20-abx125762 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
|
abx030674-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
|
abx030674-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
|
20-abx320176 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dentin Matrix Acidic Phosphoprotein 1 (DMP1) Antibody |
|
abx432613-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 (pORF)) Dmp1 ORF Vector (Rat) (pORF) |
|
ORF066076 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) DMP1 ORF Vector (Human) (pORF) |
|
ORF012851 |
ABM |
1.0 ug DNA |
EUR 354 |
 (pORF)) Dmp1 ORF Vector (Mouse) (pORF) |
|
ORF043111 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCA02543)) DMP1 ELISA Kit (Rat) (OKCA02543) |
|
OKCA02543 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
|
Description: Description of target: May have a dual function during osteoblast differentiation. In the nucleus of undifferentiated osteoblasts, unphosphorylated form acts as a transcriptional component for activation of osteoblast-specific genes like osteocalcin. During the osteoblast to osteocyte transition phase it is phosphorylated and exported into the extracellular matrix, where it regulates nucleation of hydroxyapatite.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.156 ng/mL |
 (OKEH06061)) DMP1 ELISA Kit (Rat) (OKEH06061) |
|
OKEH06061 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: May have a dual function during osteoblast differentiation. In the nucleus of undifferentiated osteoblasts, unphosphorylated form acts as a transcriptional component for activation of osteoblast-specific genes like osteocalcin. During the osteoblast to osteocyte transition phase it is phosphorylated and exported into the extracellular matrix, where it regulates nucleation of hydroxyapatite.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 41 pg/mL |
) DMP1 sgRNA CRISPR Lentivector set (Human) |
|
K0609601 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Dmp1 sgRNA CRISPR Lentivector set (Rat) |
|
K6816901 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Dmp1 sgRNA CRISPR Lentivector set (Mouse) |
|
K3915301 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Human Dentin matrix acidic phosphoprotein 1 (DMP1) |
|
1-CSB-YP006967HU |
Cusabio |
-
EUR 586.00
-
EUR 299.00
-
EUR 2172.00
-
EUR 900.00
-
EUR 1442.00
-
EUR 382.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 56 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Dentin matrix acidic phosphoprotein 1(DMP1) expressed in Yeast |
 (Target 1)) DMP1 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K0609602 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) DMP1 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K0609603 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) DMP1 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K0609604 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Dmp1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6816902 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Dmp1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6816903 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Dmp1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6816904 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Dmp1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3915302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Dmp1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3915303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Dmp1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3915304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) DMP1 Protein Vector (Mouse) (pPB-C-His) |
|
PV172442 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DMP1 Protein Vector (Mouse) (pPB-N-His) |
|
PV172443 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DMP1 Protein Vector (Mouse) (pPM-C-HA) |
|
PV172444 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DMP1 Protein Vector (Mouse) (pPM-C-His) |
|
PV172445 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DMP1 Protein Vector (Rat) (pPB-C-His) |
|
PV264302 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) DMP1 Protein Vector (Rat) (pPB-N-His) |
|
PV264303 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) DMP1 Protein Vector (Rat) (pPM-C-HA) |
|
PV264304 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) DMP1 Protein Vector (Rat) (pPM-C-His) |
|
PV264305 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) DMP1 Protein Vector (Human) (pPB-C-His) |
|
PV051401 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) DMP1 Protein Vector (Human) (pPB-N-His) |
|
PV051402 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) DMP1 Protein Vector (Human) (pPM-C-HA) |
|
PV051403 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) DMP1 Protein Vector (Human) (pPM-C-His) |
|
PV051404 |
ABM |
500 ng |
EUR 481 |
 Dmp1 3'UTR GFP Stable Cell Line |
|
TU155208 |
ABM |
1.0 ml |
Ask for price |
 Dmp1 3'UTR Luciferase Stable Cell Line |
|
TU105208 |
ABM |
1.0 ml |
Ask for price |
Dmp1 3'UTR Luciferase Stable Cell Line |
|
TU203470 |
ABM |
1.0 ml |
Ask for price |
Dmp1 3'UTR GFP Stable Cell Line |
|
TU253470 |
ABM |
1.0 ml |
Ask for price |
 DMP1 3'UTR GFP Stable Cell Line |
|
TU056089 |
ABM |
1.0 ml |
EUR 1394 |
 DMP1 3'UTR Luciferase Stable Cell Line |
|
TU006089 |
ABM |
1.0 ml |
EUR 1394 |
 : 96 Wells (OKEH01476)) DMP1 ELISA Kit (Human) : 96 Wells (OKEH01476) |
|
OKEH01476 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL |
 ELISA Kit) Mouse Dentin Matrix Protein 1 (DMP1) ELISA Kit |
|
CSB-E14252m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Dentin Matrix Protein 1 (DMP1) ELISA Kit |
|
1-CSB-E14252m |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 ELISA kit) Human Dentin Matrix Protein 1 (DMP1) ELISA kit |
|
CSB-E13029h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Dentin Matrix Protein 1 (DMP1) ELISA kit |
|
1-CSB-E13029h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human Dentin Matrix Protein 1 (DMP1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 (CMV) (pLenti-GIII-CMV)) DMP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV658999 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) DMP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV659003 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) DMP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV659004 |
ABM |
1.0 ug DNA |
EUR 682 |
 Recombinant Dog DMP1 Protein, His-SUMO, E.coli-100ug |
|
QP6934-ec-100ug |
EnQuireBio |
100ug |
EUR 707 |
 Recombinant Dog DMP1 Protein, His-SUMO, E.coli-10ug |
|
QP6934-ec-10ug |
EnQuireBio |
10ug |
EUR 326 |
 Recombinant Dog DMP1 Protein, His-SUMO, E.coli-1mg |
|
QP6934-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
 Recombinant Dog DMP1 Protein, His-SUMO, E.coli-200ug |
|
QP6934-ec-200ug |
EnQuireBio |
200ug |
EUR 1115 |
 Recombinant Dog DMP1 Protein, His-SUMO, E.coli-500ug |
|
QP6934-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
 Recombinant Dog DMP1 Protein, His-SUMO, E.coli-50ug |
|
QP6934-ec-50ug |
EnQuireBio |
50ug |
EUR 435 |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
 JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
|
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
DMP1 Rabbit Polyclonal Antibody
