DUSP4 Rabbit Polyclonal Antibody

DUSP4 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

DUSP4 Polyclonal Antibody
ES8921-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DUSP4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
DUSP4 Polyclonal Antibody
ABP58432-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DUSP4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP4 from Human, Mouse, Rat. This DUSP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DUSP4 protein
DUSP4 Polyclonal Antibody
ABP58432-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DUSP4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP4 from Human, Mouse, Rat. This DUSP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DUSP4 protein
DUSP4 Polyclonal Antibody
ABP58432-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DUSP4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP4 from Human, Mouse, Rat. This DUSP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DUSP4 protein
DUSP4 Rabbit pAb
A2726-100ul 100 ul
EUR 308
DUSP4 Rabbit pAb
A2726-200ul 200 ul
EUR 459
DUSP4 Rabbit pAb
A2726-20ul 20 ul
EUR 183
DUSP4 Rabbit pAb
A2726-50ul 50 ul
EUR 223
DUSP4 antibody
10R-1447 100 ug
EUR 512
Description: Mouse monoclonal DUSP4 antibody
DUSP4 Antibody
31070-100ul 100ul
EUR 252
DUSP4 Antibody
31070-50ul 50ul
EUR 187
DUSP4 antibody
70R-16957 50 ul
EUR 435
Description: Rabbit polyclonal DUSP4 antibody
DUSP4 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:150
DUSP4 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
DUSP4 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
DUSP4 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:200-1:500
DUSP4 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
DUSP4 Conjugated Antibody
C31070 100ul
EUR 397
DUSP1 / DUSP4 Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-DUSP4 Antibody
A30480 100ul
EUR 397
Description: Rabbit Polyclonal DUSP4 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
DUSP1/DUSP4 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DUSP1/DUSP4. Recognizes DUSP1/DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
Anti-DUSP4 antibody
STJ99639 200 µl
EUR 197
Description: Rabbit polyclonal to DUSP4.
Anti-DUSP4 antibody
STJ23443 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported.
Dusp4/ Rat Dusp4 ELISA Kit
ELI-31610r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA11442 100 ug
EUR 403
Description: Rabbit polyclonal to DUSP4
YF-PA23613 50 ul
EUR 334
Description: Mouse polyclonal to DUSP4
DUSP4 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DUSP4 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DUSP4 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Antibody for Human DUSP4
SPC-1125D 0.1ml
EUR 354
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is unconjugated.
Antibody for Human DUSP4
SPC-1125D-A390 0.1ml
EUR 401
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 390.
Antibody for Human DUSP4
SPC-1125D-A488 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 488.
Antibody for Human DUSP4
SPC-1125D-A565 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 565.
Antibody for Human DUSP4
SPC-1125D-A594 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 594.
Antibody for Human DUSP4
SPC-1125D-A633 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 633.
Antibody for Human DUSP4
SPC-1125D-A655 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 655.
Antibody for Human DUSP4
SPC-1125D-A680 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 680.
Antibody for Human DUSP4
SPC-1125D-A700 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 700.
Antibody for Human DUSP4
SPC-1125D-ALP 0.1ml
EUR 394
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Alkaline Phosphatase.
Antibody for Human DUSP4
SPC-1125D-APC 0.1ml
EUR 399
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to APC .
Antibody for Human DUSP4
SPC-1125D-APCCY7 0.1ml
EUR 471
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to APC/Cy7.
Antibody for Human DUSP4
SPC-1125D-BI 0.1ml
EUR 396
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Biotin.
Antibody for Human DUSP4
SPC-1125D-DY350 0.1ml
EUR 475
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 350.
Antibody for Human DUSP4
SPC-1125D-DY405 0.1ml
EUR 452
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 405.
Antibody for Human DUSP4
SPC-1125D-DY488 0.1ml
EUR 432
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 488.
Antibody for Human DUSP4
SPC-1125D-DY594 0.1ml
EUR 436
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 594.
Antibody for Human DUSP4
SPC-1125D-DY633 0.1ml
EUR 426
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 633.
Antibody for Human DUSP4
SPC-1125D-FITC 0.1ml
EUR 392
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to FITC.
Antibody for Human DUSP4
SPC-1125D-HRP 0.1ml
EUR 388
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to HRP.
Antibody for Human DUSP4
SPC-1125D-P594 0.1ml
EUR 407
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to PE/ATTO 594.
Antibody for Human DUSP4
SPC-1125D-PCP 0.1ml
EUR 399
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to PerCP.
Antibody for Human DUSP4
SPC-1125D-RPE 0.1ml
EUR 397
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to RPE .
Antibody for Human DUSP4
SPC-1125D-STR 0.1ml
EUR 398
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Streptavidin.
DUSP4 Blocking Peptide
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
DUSP4 cloning plasmid
CSB-CL619752HU-10ug 10ug
EUR 441
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atggtgacgatggaggagctgcgggagatggactgcagtgtgctcaaaaggctgatgaaccgggacgagaatggcggcggcgcgggcggcagcggcagccacggcaccctggggctgccgagcggcggcaagtgcctgctgctggactgcagaccgttcctggcgcacagcgcgg
  • Show more
Description: A cloning plasmid for the DUSP4 gene.
Anti-DUSP4 (1D12)
YF-MA12746 100 ug
EUR 363
Description: Mouse monoclonal to DUSP4
DUSP1 / DUSP4 (pS296 / 318) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
abx033958-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
abx033958-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phospho-DUSP1/DUSP4 (S296/318) Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-DUSP1/DUSP4 (S296/318). Recognizes Phospho-DUSP1/DUSP4 (S296/318) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
abx595822-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Mouse DUSP4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat DUSP4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELA-E12250h 96 Tests
EUR 824
EF008492 96 Tests
EUR 689
Human DUSP4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DUSP4 Recombinant Protein (Human)
RP009973 100 ug Ask for price
DUSP4 Recombinant Protein (Rat)
RP198833 100 ug Ask for price
DUSP4 Recombinant Protein (Mouse)
RP130319 100 ug Ask for price
Anti-DUSP4 (3D6-G6)
YF-MA12745 100 ug
EUR 363
Description: Mouse monoclonal to DUSP4
DUSP4 Colorimetric Cell-Based ELISA
EKC1789 100ul
EUR 572
DUSP4 ORF Vector (Human) (pORF)
ORF003325 1.0 ug DNA
EUR 95
Dusp4 ORF Vector (Rat) (pORF)
ORF066279 1.0 ug DNA
EUR 506
h DUSP4 inducible lentiviral particles
LVP205 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, DUSP4, is fully sequence verified and matched to NCBI accession ID: NM_001394
Dusp4 ORF Vector (Mouse) (pORF)
ORF043441 1.0 ug DNA
EUR 506
DUSP4 ELISA Kit (Human) (OKEH02216)
OKEH02216 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL
DUSP4 ELISA Kit (Chicken) (OKEH07819)
OKEH07819 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
DUSP4 sgRNA CRISPR Lentivector set (Human)
K0638101 3 x 1.0 ug
EUR 339
Dusp4 sgRNA CRISPR Lentivector set (Mouse)
K3894201 3 x 1.0 ug
EUR 339
Dusp4 sgRNA CRISPR Lentivector set (Rat)
K6896701 3 x 1.0 ug
EUR 339
DUSP4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0638102 1.0 ug DNA
EUR 154
DUSP4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0638103 1.0 ug DNA
EUR 154
DUSP4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0638104 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3894202 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3894203 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3894204 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6896702 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6896703 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6896704 1.0 ug DNA
EUR 154
DUSP4 Protein Vector (Mouse) (pPB-C-His)
PV173762 500 ng
EUR 603
DUSP4 Protein Vector (Mouse) (pPB-N-His)
PV173763 500 ng
EUR 603
DUSP4 Protein Vector (Mouse) (pPM-C-HA)
PV173764 500 ng
EUR 603
DUSP4 Protein Vector (Mouse) (pPM-C-His)
PV173765 500 ng
EUR 603
DUSP4 Protein Vector (Human) (pPB-C-His)
PV013297 500 ng
EUR 329
DUSP4 Protein Vector (Human) (pPB-N-His)
PV013298 500 ng
EUR 329
DUSP4 Protein Vector (Human) (pPM-C-HA)
PV013299 500 ng
EUR 329
DUSP4 Protein Vector (Human) (pPM-C-His)
PV013300 500 ng
EUR 329
DUSP4 Protein Vector (Rat) (pPB-C-His)
PV265114 500 ng
EUR 603
DUSP4 Protein Vector (Rat) (pPB-N-His)
PV265115 500 ng
EUR 603
DUSP4 Protein Vector (Rat) (pPM-C-HA)
PV265116 500 ng
EUR 603
DUSP4 Protein Vector (Rat) (pPM-C-His)
PV265117 500 ng
EUR 603
Dusp4 3'UTR Luciferase Stable Cell Line
TU203696 1.0 ml Ask for price
Dusp4 3'UTR GFP Stable Cell Line
TU155462 1.0 ml Ask for price
DUSP4 3'UTR Luciferase Stable Cell Line
TU006383 1.0 ml
EUR 2333
Dusp4 3'UTR Luciferase Stable Cell Line
TU105462 1.0 ml Ask for price
DUSP4 3'UTR GFP Stable Cell Line
TU056383 1.0 ml
EUR 2333
Dusp4 3'UTR GFP Stable Cell Line
TU253696 1.0 ml Ask for price
DUSP4 Colorimetric Cell-Based ELISA Kit (OKAG01312)
OKAG01312 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG5 Rabbit Polyclonal Antibody
ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG7 Rabbit Polyclonal Antibody
ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG13 Rabbit Polyclonal Antibody
ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG14L Rabbit Polyclonal Antibody
ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NBR1 Rabbit Polyclonal Antibody
ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Gab1 Rabbit Polyclonal Antibody
ES8582-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ERK1 Rabbit Polyclonal Antibody
ES8583-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

DUSP4 Rabbit Polyclonal Antibody

Back To Top