DUSP4 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
DUSP4 Polyclonal Antibody |
ABP58432-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human DUSP4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DUSP4 from Human, Mouse, Rat. This DUSP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DUSP4 protein |
DUSP4 Polyclonal Antibody |
ABP58432-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human DUSP4 protein
- Applications tips:
|
Description: A polyclonal antibody for detection of DUSP4 from Human, Mouse, Rat. This DUSP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DUSP4 protein |
DUSP4 Polyclonal Antibody |
ES8921-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against DUSP4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DUSP4 Polyclonal Antibody |
ES8921-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against DUSP4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
DUSP4 Rabbit pAb |
A2726-100ul |
Abclonal |
100 ul |
EUR 308 |
DUSP4 Rabbit pAb |
A2726-200ul |
Abclonal |
200 ul |
EUR 459 |
DUSP4 Rabbit pAb |
A2726-20ul |
Abclonal |
20 ul |
EUR 183 |
DUSP4 Rabbit pAb |
A2726-50ul |
Abclonal |
50 ul |
EUR 223 |
DUSP4 Antibody |
31070-100ul |
SAB |
100ul |
EUR 252 |
DUSP4 Antibody |
31070-50ul |
SAB |
50ul |
EUR 187 |
DUSP4 antibody |
70R-16957 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DUSP4 antibody |
DUSP4 antibody |
10R-1447 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal DUSP4 antibody |
DUSP4 Antibody |
1-CSB-PA126732 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200 |
DUSP4 Antibody |
1-CSB-PA619752LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:200-1:500 |
DUSP4 Antibody |
1-CSB-PA921264 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:150 |
DUSP4 Antibody |
1-CSB-PA007256GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
DUSP4 Antibody |
1-CSB-PA007842 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
DUSP1/DUSP4 Antibody |
1-CSB-PA003246 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against DUSP1/DUSP4. Recognizes DUSP1/DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000 |
DUSP4 Conjugated Antibody |
C31070 |
SAB |
100ul |
EUR 397 |
DUSP1 / DUSP4 Antibody |
20-abx328513 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-DUSP4 Antibody |
A30480 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal DUSP4 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat. |
Anti-DUSP4 antibody |
STJ23443 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported. |
Anti-DUSP4 antibody |
STJ99639 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to DUSP4. |
DUSP4 siRNA |
20-abx901605 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DUSP4 siRNA |
20-abx914758 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DUSP4 siRNA |
20-abx914759 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DUSP4 |
YF-PA11442 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to DUSP4 |
anti-DUSP4 |
YF-PA23613 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to DUSP4 |
DUSP4 Antibody, HRP conjugated |
1-CSB-PA619752LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
DUSP4 Antibody, FITC conjugated |
1-CSB-PA619752LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
DUSP4 Antibody, Biotin conjugated |
1-CSB-PA619752LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Antibody for Human DUSP4 |
SPC-1125D |
Stressmarq |
0.1ml |
EUR 354 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is unconjugated. |
Antibody for Human DUSP4 |
SPC-1125D-A390 |
Stressmarq |
0.1ml |
EUR 401 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 390. |
Antibody for Human DUSP4 |
SPC-1125D-A488 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 488. |
Antibody for Human DUSP4 |
SPC-1125D-A565 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 565. |
Antibody for Human DUSP4 |
SPC-1125D-A594 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 594. |
Antibody for Human DUSP4 |
SPC-1125D-A633 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 633. |
Antibody for Human DUSP4 |
SPC-1125D-A655 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 655. |
Antibody for Human DUSP4 |
SPC-1125D-A680 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 680. |
Antibody for Human DUSP4 |
SPC-1125D-A700 |
Stressmarq |
0.1ml |
EUR 400 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 700. |
Antibody for Human DUSP4 |
SPC-1125D-ALP |
Stressmarq |
0.1ml |
EUR 394 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human DUSP4 |
SPC-1125D-APC |
Stressmarq |
0.1ml |
EUR 399 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to APC . |
Antibody for Human DUSP4 |
SPC-1125D-APCCY7 |
Stressmarq |
0.1ml |
EUR 471 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to APC/Cy7. |
Antibody for Human DUSP4 |
SPC-1125D-BI |
Stressmarq |
0.1ml |
EUR 396 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Biotin. |
Antibody for Human DUSP4 |
SPC-1125D-DY350 |
Stressmarq |
0.1ml |
EUR 475 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 350. |
Antibody for Human DUSP4 |
SPC-1125D-DY405 |
Stressmarq |
0.1ml |
EUR 452 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 405. |
Antibody for Human DUSP4 |
SPC-1125D-DY488 |
Stressmarq |
0.1ml |
EUR 432 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 488. |
Antibody for Human DUSP4 |
SPC-1125D-DY594 |
Stressmarq |
0.1ml |
EUR 436 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 594. |
Antibody for Human DUSP4 |
SPC-1125D-DY633 |
Stressmarq |
0.1ml |
EUR 426 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 633. |
Antibody for Human DUSP4 |
SPC-1125D-FITC |
Stressmarq |
0.1ml |
EUR 392 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to FITC. |
Antibody for Human DUSP4 |
SPC-1125D-HRP |
Stressmarq |
0.1ml |
EUR 388 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to HRP. |
Antibody for Human DUSP4 |
SPC-1125D-P594 |
Stressmarq |
0.1ml |
EUR 407 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to PE/ATTO 594. |
Antibody for Human DUSP4 |
SPC-1125D-PCP |
Stressmarq |
0.1ml |
EUR 399 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to PerCP. |
Antibody for Human DUSP4 |
SPC-1125D-RPE |
Stressmarq |
0.1ml |
EUR 397 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to RPE . |
Antibody for Human DUSP4 |
SPC-1125D-STR |
Stressmarq |
0.1ml |
EUR 398 |
- DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
- Show more
|
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Streptavidin. |
DUSP4 Blocking Peptide |
20-abx061678 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DUSP4 cloning plasmid |
CSB-CL619752HU-10ug |
Cusabio |
10ug |
EUR 441 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1185
- Sequence: atggtgacgatggaggagctgcgggagatggactgcagtgtgctcaaaaggctgatgaaccgggacgagaatggcggcggcgcgggcggcagcggcagccacggcaccctggggctgccgagcggcggcaagtgcctgctgctggactgcagaccgttcctggcgcacagcgcgg
- Show more
|
Description: A cloning plasmid for the DUSP4 gene. |
Anti-DUSP4 (1D12) |
YF-MA12746 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DUSP4 |
DUSP1 / DUSP4 (pS296 / 318) Antibody |
20-abx329024 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-DUSP1/DUSP4 (S296/318) Antibody |
1-CSB-PA000716 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-DUSP1/DUSP4 (S296/318). Recognizes Phospho-DUSP1/DUSP4 (S296/318) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000 |
Dual Specificity Phosphatase 4 (DUSP4) Antibody |
20-abx002787 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 4 (DUSP4) Antibody |
20-abx214186 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 4 (DUSP4) Antibody |
20-abx214781 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 4 (DUSP4) Antibody |
20-abx112181 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 4 (DUSP4) Antibody |
20-abx134979 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 4 (DUSP4) Antibody |
abx033958-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 4 (DUSP4) Antibody |
abx033958-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 4 (DUSP4) Antibody |
20-abx329965 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Dual Specificity Phosphatase 4 (DUSP4) Antibody |
20-abx002069 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rat DUSP4 shRNA Plasmid |
20-abx986076 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DUSP4 Cell ELISA Kit |
abx595822-96tests |
Abbexa |
96 tests |
EUR 637 |
- Shipped within 1-2 weeks.
|
Mouse DUSP4 shRNA Plasmid |
20-abx983279 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human DUSP4 shRNA Plasmid |
20-abx951294 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
DUSP4 Recombinant Protein (Human) |
RP009973 |
ABM |
100 ug |
Ask for price |
DUSP4 Recombinant Protein (Rat) |
RP198833 |
ABM |
100 ug |
Ask for price |
DUSP4 Recombinant Protein (Mouse) |
RP130319 |
ABM |
100 ug |
Ask for price |
Anti-DUSP4 (3D6-G6) |
YF-MA12745 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DUSP4 |
DUSP4 Colorimetric Cell-Based ELISA |
EKC1789 |
BosterBio |
100ul |
EUR 572 |
Dusp4 ORF Vector (Rat) (pORF) |
ORF066279 |
ABM |
1.0 ug DNA |
EUR 506 |
h DUSP4 inducible lentiviral particles |
LVP205 |
GenTarget |
1x107 IFU/ml x 200ul |
EUR 451 |
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, DUSP4, is fully sequence verified and matched to NCBI accession ID: NM_001394 |
DUSP4 ORF Vector (Human) (pORF) |
ORF003325 |
ABM |
1.0 ug DNA |
EUR 95 |
Dusp4 ORF Vector (Mouse) (pORF) |
ORF043441 |
ABM |
1.0 ug DNA |
EUR 506 |
DUSP4 ELISA Kit (Human) (OKEH02216) |
OKEH02216 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL |
DUSP4 ELISA Kit (Chicken) (OKEH07819) |
OKEH07819 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
DUSP4 sgRNA CRISPR Lentivector set (Human) |
K0638101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dusp4 sgRNA CRISPR Lentivector set (Rat) |
K6896701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Dusp4 sgRNA CRISPR Lentivector set (Mouse) |
K3894201 |
ABM |
3 x 1.0 ug |
EUR 339 |
DUSP4 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0638102 |
ABM |
1.0 ug DNA |
EUR 154 |
DUSP4 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0638103 |
ABM |
1.0 ug DNA |
EUR 154 |
DUSP4 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0638104 |
ABM |
1.0 ug DNA |
EUR 154 |
Dusp4 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6896702 |
ABM |
1.0 ug DNA |
EUR 154 |
Dusp4 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6896703 |
ABM |
1.0 ug DNA |
EUR 154 |
Dusp4 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6896704 |
ABM |
1.0 ug DNA |
EUR 154 |
Dusp4 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3894202 |
ABM |
1.0 ug DNA |
EUR 154 |
Dusp4 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3894203 |
ABM |
1.0 ug DNA |
EUR 154 |
Dusp4 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3894204 |
ABM |
1.0 ug DNA |
EUR 154 |
DUSP4 Protein Vector (Mouse) (pPB-C-His) |
PV173762 |
ABM |
500 ng |
EUR 603 |
DUSP4 Protein Vector (Mouse) (pPB-N-His) |
PV173763 |
ABM |
500 ng |
EUR 603 |
DUSP4 Protein Vector (Mouse) (pPM-C-HA) |
PV173764 |
ABM |
500 ng |
EUR 603 |
DUSP4 Protein Vector (Mouse) (pPM-C-His) |
PV173765 |
ABM |
500 ng |
EUR 603 |
DUSP4 Protein Vector (Rat) (pPB-C-His) |
PV265114 |
ABM |
500 ng |
EUR 603 |
DUSP4 Protein Vector (Rat) (pPB-N-His) |
PV265115 |
ABM |
500 ng |
EUR 603 |
DUSP4 Protein Vector (Rat) (pPM-C-HA) |
PV265116 |
ABM |
500 ng |
EUR 603 |
DUSP4 Protein Vector (Rat) (pPM-C-His) |
PV265117 |
ABM |
500 ng |
EUR 603 |
DUSP4 Protein Vector (Human) (pPB-C-His) |
PV013297 |
ABM |
500 ng |
EUR 329 |
DUSP4 Protein Vector (Human) (pPB-N-His) |
PV013298 |
ABM |
500 ng |
EUR 329 |
DUSP4 Protein Vector (Human) (pPM-C-HA) |
PV013299 |
ABM |
500 ng |
EUR 329 |
DUSP4 Protein Vector (Human) (pPM-C-His) |
PV013300 |
ABM |
500 ng |
EUR 329 |
Dusp4 3'UTR GFP Stable Cell Line |
TU155462 |
ABM |
1.0 ml |
Ask for price |
Dusp4 3'UTR Luciferase Stable Cell Line |
TU105462 |
ABM |
1.0 ml |
Ask for price |
Dusp4 3'UTR Luciferase Stable Cell Line |
TU203696 |
ABM |
1.0 ml |
Ask for price |
Dusp4 3'UTR GFP Stable Cell Line |
TU253696 |
ABM |
1.0 ml |
Ask for price |
DUSP4 3'UTR GFP Stable Cell Line |
TU056383 |
ABM |
1.0 ml |
EUR 2333 |
DUSP4 3'UTR Luciferase Stable Cell Line |
TU006383 |
ABM |
1.0 ml |
EUR 2333 |
DUSP4 Colorimetric Cell-Based ELISA Kit (OKAG01312) |
OKAG01312 |
Aviva Systems Biology |
96 Wells |
EUR 596 |
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity: |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
DUSP4 Rabbit Polyclonal Antibody