DUSP4 Rabbit Polyclonal Antibody

DUSP4 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

DUSP4 Polyclonal Antibody
ABP58432-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DUSP4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP4 from Human, Mouse, Rat. This DUSP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DUSP4 protein
DUSP4 Polyclonal Antibody
ABP58432-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DUSP4 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DUSP4 from Human, Mouse, Rat. This DUSP4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DUSP4 protein
DUSP4 Polyclonal Antibody
ES8921-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DUSP4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
DUSP4 Polyclonal Antibody
ES8921-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DUSP4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
DUSP4 Rabbit pAb
A2726-100ul 100 ul
EUR 308
DUSP4 Rabbit pAb
A2726-200ul 200 ul
EUR 459
DUSP4 Rabbit pAb
A2726-20ul 20 ul
EUR 183
DUSP4 Rabbit pAb
A2726-50ul 50 ul
EUR 223
DUSP4 Antibody
31070-100ul 100ul
EUR 252
DUSP4 Antibody
31070-50ul 50ul
EUR 187
DUSP4 antibody
70R-16957 50 ul
EUR 435
Description: Rabbit polyclonal DUSP4 antibody
DUSP4 antibody
10R-1447 100 ug
EUR 512
Description: Mouse monoclonal DUSP4 antibody
DUSP4 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200
DUSP4 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:200-1:500
DUSP4 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:150
DUSP4 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
DUSP4 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
DUSP1/DUSP4 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DUSP1/DUSP4. Recognizes DUSP1/DUSP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
DUSP4 Conjugated Antibody
C31070 100ul
EUR 397
DUSP1 / DUSP4 Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Anti-DUSP4 Antibody
A30480 100ul
EUR 397
Description: Rabbit Polyclonal DUSP4 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-DUSP4 antibody
STJ23443 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported.
Anti-DUSP4 antibody
STJ99639 200 µl
EUR 197
Description: Rabbit polyclonal to DUSP4.
Dusp4/ Rat Dusp4 ELISA Kit
ELI-31610r 96 Tests
EUR 886
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA11442 100 ug
EUR 403
Description: Rabbit polyclonal to DUSP4
YF-PA23613 50 ul
EUR 334
Description: Mouse polyclonal to DUSP4
DUSP4 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
DUSP4 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
DUSP4 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DUSP4. Recognizes DUSP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Antibody for Human DUSP4
SPC-1125D 0.1ml
EUR 354
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is unconjugated.
Antibody for Human DUSP4
SPC-1125D-A390 0.1ml
EUR 401
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 390.
Antibody for Human DUSP4
SPC-1125D-A488 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 488.
Antibody for Human DUSP4
SPC-1125D-A565 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 565.
Antibody for Human DUSP4
SPC-1125D-A594 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 594.
Antibody for Human DUSP4
SPC-1125D-A633 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 633.
Antibody for Human DUSP4
SPC-1125D-A655 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 655.
Antibody for Human DUSP4
SPC-1125D-A680 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 680.
Antibody for Human DUSP4
SPC-1125D-A700 0.1ml
EUR 400
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to ATTO 700.
Antibody for Human DUSP4
SPC-1125D-ALP 0.1ml
EUR 394
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Alkaline Phosphatase.
Antibody for Human DUSP4
SPC-1125D-APC 0.1ml
EUR 399
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to APC .
Antibody for Human DUSP4
SPC-1125D-APCCY7 0.1ml
EUR 471
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to APC/Cy7.
Antibody for Human DUSP4
SPC-1125D-BI 0.1ml
EUR 396
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Biotin.
Antibody for Human DUSP4
SPC-1125D-DY350 0.1ml
EUR 475
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 350.
Antibody for Human DUSP4
SPC-1125D-DY405 0.1ml
EUR 452
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 405.
Antibody for Human DUSP4
SPC-1125D-DY488 0.1ml
EUR 432
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 488.
Antibody for Human DUSP4
SPC-1125D-DY594 0.1ml
EUR 436
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 594.
Antibody for Human DUSP4
SPC-1125D-DY633 0.1ml
EUR 426
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Dylight 633.
Antibody for Human DUSP4
SPC-1125D-FITC 0.1ml
EUR 392
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to FITC.
Antibody for Human DUSP4
SPC-1125D-HRP 0.1ml
EUR 388
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to HRP.
Antibody for Human DUSP4
SPC-1125D-P594 0.1ml
EUR 407
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to PE/ATTO 594.
Antibody for Human DUSP4
SPC-1125D-PCP 0.1ml
EUR 399
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to PerCP.
Antibody for Human DUSP4
SPC-1125D-RPE 0.1ml
EUR 397
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to RPE .
Antibody for Human DUSP4
SPC-1125D-STR 0.1ml
EUR 398
  • DUSP4 is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mi
  • Show more
Description: A polyclonal antibody for DUSP4 from Human | Mouse. The antibody is produced in rabbit after immunization with Human A synthetic peptide of human DUSP4 (AA 257-271). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This DUSP4 antibody is conjugated to Streptavidin.
DUSP4 Blocking Peptide
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
DUSP4 cloning plasmid
CSB-CL619752HU-10ug 10ug
EUR 441
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1185
  • Sequence: atggtgacgatggaggagctgcgggagatggactgcagtgtgctcaaaaggctgatgaaccgggacgagaatggcggcggcgcgggcggcagcggcagccacggcaccctggggctgccgagcggcggcaagtgcctgctgctggactgcagaccgttcctggcgcacagcgcgg
  • Show more
Description: A cloning plasmid for the DUSP4 gene.
Anti-DUSP4 (1D12)
YF-MA12746 100 ug
EUR 363
Description: Mouse monoclonal to DUSP4
DUSP1 / DUSP4 (pS296 / 318) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Phospho-DUSP1/DUSP4 (S296/318) Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-DUSP1/DUSP4 (S296/318). Recognizes Phospho-DUSP1/DUSP4 (S296/318) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
abx033958-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
abx033958-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Dual Specificity Phosphatase 4 (DUSP4) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
ELA-E12250h 96 Tests
EUR 824
EF008492 96 Tests
EUR 689
Rat DUSP4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
abx595822-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Mouse DUSP4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human DUSP4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
DUSP4 Recombinant Protein (Human)
RP009973 100 ug Ask for price
DUSP4 Recombinant Protein (Rat)
RP198833 100 ug Ask for price
DUSP4 Recombinant Protein (Mouse)
RP130319 100 ug Ask for price
Anti-DUSP4 (3D6-G6)
YF-MA12745 100 ug
EUR 363
Description: Mouse monoclonal to DUSP4
DUSP4 Colorimetric Cell-Based ELISA
EKC1789 100ul
EUR 572
Dusp4 ORF Vector (Rat) (pORF)
ORF066279 1.0 ug DNA
EUR 506
h DUSP4 inducible lentiviral particles
LVP205 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made tet-inducible lentiviral particles expressing a human gene with a Blasticidin-RFP fusion marker (Dual selection). The expressed human gene, DUSP4, is fully sequence verified and matched to NCBI accession ID: NM_001394
DUSP4 ORF Vector (Human) (pORF)
ORF003325 1.0 ug DNA
EUR 95
Dusp4 ORF Vector (Mouse) (pORF)
ORF043441 1.0 ug DNA
EUR 506
DUSP4 ELISA Kit (Chicken) (OKEH07819)
OKEH07819 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
DUSP4 ELISA Kit (Human) (OKEH02216)
OKEH02216 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK1, ERK2 and JNK, is expressed in a variety of tissues, and is localized in the nucleus. Two alternatively spliced transcript variants, encoding distinct isoforms, have been observed for this gene. In addition, multiple polyadenylation sites have been reported.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL
DUSP4 sgRNA CRISPR Lentivector set (Human)
K0638101 3 x 1.0 ug
EUR 339
Dusp4 sgRNA CRISPR Lentivector set (Rat)
K6896701 3 x 1.0 ug
EUR 339
Dusp4 sgRNA CRISPR Lentivector set (Mouse)
K3894201 3 x 1.0 ug
EUR 339
DUSP4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0638102 1.0 ug DNA
EUR 154
DUSP4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0638103 1.0 ug DNA
EUR 154
DUSP4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0638104 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6896702 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6896703 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6896704 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3894202 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3894203 1.0 ug DNA
EUR 154
Dusp4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3894204 1.0 ug DNA
EUR 154
DUSP4 Protein Vector (Mouse) (pPB-C-His)
PV173762 500 ng
EUR 603
DUSP4 Protein Vector (Mouse) (pPB-N-His)
PV173763 500 ng
EUR 603
DUSP4 Protein Vector (Mouse) (pPM-C-HA)
PV173764 500 ng
EUR 603
DUSP4 Protein Vector (Mouse) (pPM-C-His)
PV173765 500 ng
EUR 603
DUSP4 Protein Vector (Rat) (pPB-C-His)
PV265114 500 ng
EUR 603
DUSP4 Protein Vector (Rat) (pPB-N-His)
PV265115 500 ng
EUR 603
DUSP4 Protein Vector (Rat) (pPM-C-HA)
PV265116 500 ng
EUR 603
DUSP4 Protein Vector (Rat) (pPM-C-His)
PV265117 500 ng
EUR 603
DUSP4 Protein Vector (Human) (pPB-C-His)
PV013297 500 ng
EUR 329
DUSP4 Protein Vector (Human) (pPB-N-His)
PV013298 500 ng
EUR 329
DUSP4 Protein Vector (Human) (pPM-C-HA)
PV013299 500 ng
EUR 329
DUSP4 Protein Vector (Human) (pPM-C-His)
PV013300 500 ng
EUR 329
Dusp4 3'UTR GFP Stable Cell Line
TU155462 1.0 ml Ask for price
Dusp4 3'UTR Luciferase Stable Cell Line
TU105462 1.0 ml Ask for price
Dusp4 3'UTR Luciferase Stable Cell Line
TU203696 1.0 ml Ask for price
Dusp4 3'UTR GFP Stable Cell Line
TU253696 1.0 ml Ask for price
DUSP4 3'UTR GFP Stable Cell Line
TU056383 1.0 ml
EUR 2333
DUSP4 3'UTR Luciferase Stable Cell Line
TU006383 1.0 ml
EUR 2333
DUSP4 Colorimetric Cell-Based ELISA Kit (OKAG01312)
OKAG01312 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187
Alliinase Rabbit Polyclonal Antibody
38042-100ul 100ul
EUR 252
Alliinase Rabbit Polyclonal Antibody
38042-50ul 50ul
EUR 187
ECFP Rabbit Polyclonal Antibody
38077-100ul 100ul
EUR 252
ECFP Rabbit Polyclonal Antibody
38077-50ul 50ul
EUR 187
EYFP Rabbit Polyclonal Antibody
38078-100ul 100ul
EUR 252
EYFP Rabbit Polyclonal Antibody
38078-50ul 50ul
EUR 187
mOrange Rabbit Polyclonal Antibody
38079-100ul 100ul
EUR 252
mOrange Rabbit Polyclonal Antibody
38079-50ul 50ul
EUR 187
mStrawberry Rabbit Polyclonal Antibody
38083-100ul 100ul
EUR 252
mStrawberry Rabbit Polyclonal Antibody
38083-50ul 50ul
EUR 187
AmCyan Rabbit Polyclonal Antibody
38086-100ul 100ul
EUR 252
AmCyan Rabbit Polyclonal Antibody
38086-50ul 50ul
EUR 187
EBFP Rabbit Polyclonal Antibody
38087-100ul 100ul
EUR 252
EBFP Rabbit Polyclonal Antibody
38087-50ul 50ul
EUR 187
Vimentin Rabbit Polyclonal Antibody
38104-100ul 100ul
EUR 252
Vimentin Rabbit Polyclonal Antibody
38104-50ul 50ul
EUR 187
LDHD Rabbit Polyclonal Antibody
38105-100ul 100ul
EUR 252
LDHD Rabbit Polyclonal Antibody
38105-50ul 50ul
EUR 187
GAPDH Rabbit Polyclonal Antibody
A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
GAPDH Rabbit Polyclonal Antibody
A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
Rabbit Hemoglobin Polyclonal Antibody
A53073 100 µg
EUR 570.55
Description: The best epigenetics products
Met Rabbit Polyclonal Antibody
ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
Met Rabbit Polyclonal Antibody
ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
VEGF Rabbit Polyclonal Antibody
ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
VEGF Rabbit Polyclonal Antibody
ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
CD10 Rabbit Polyclonal Antibody
ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
CD10 Rabbit Polyclonal Antibody
ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
NM23A Rabbit Polyclonal Antibody
ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
NM23A Rabbit Polyclonal Antibody
ABP57462-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
ATM Rabbit Polyclonal Antibody
ABP57463-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57463-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
ATM Rabbit Polyclonal Antibody
ABP57464-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of ATM of ATM
  • Applications tips:
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
HSC70 Rabbit Polyclonal Antibody
ABP57565-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSC70 Rabbit Polyclonal Antibody
ABP57565-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
  • Applications tips:
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
HSP40 Rabbit Polyclonal Antibody
ABP57566-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP40 Rabbit Polyclonal Antibody
ABP57566-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP40
  • Applications tips:
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
HSP90Alpha Rabbit Polyclonal Antibody
ABP57567-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of HSP90?
  • Applications tips:
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
JAK1 Rabbit Polyclonal Antibody
ABP57569-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK1 Rabbit Polyclonal Antibody
ABP57569-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK1
  • Applications tips:
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
JAK2 Rabbit Polyclonal Antibody
ABP57570-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JAK2 Rabbit Polyclonal Antibody
ABP57570-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JAK2
  • Applications tips:
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK2 Rabbit Polyclonal Antibody
ABP57571-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK2
  • Applications tips:
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
JNK3 Rabbit Polyclonal Antibody
ABP57572-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
JNK3 Rabbit Polyclonal Antibody
ABP57572-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of JNK3
  • Applications tips:
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
MEK2 Rabbit Polyclonal Antibody
ABP57573-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK2 Rabbit Polyclonal Antibody
ABP57573-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of MEK2
  • Applications tips:
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
MEK3 Rabbit Polyclonal Antibody
ABP57574-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
MEK3 Rabbit Polyclonal Antibody
ABP57574-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of MEK3
  • Applications tips:
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

DUSP4 Rabbit Polyclonal Antibody

Back To Top