DYRK2 Rabbit Polyclonal Antibody

DYRK2 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

DYRK2 Polyclonal Antibody
ABP58440-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400
DYRK2 Polyclonal Antibody
ABP58440-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400
DYRK2 Polyclonal Antibody
ABP58440-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein at amino acid sequence of 320-400
DYRK2 Polyclonal Antibody
ABP58441-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein
DYRK2 Polyclonal Antibody
ABP58441-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein
DYRK2 Polyclonal Antibody
ABP58441-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human DYRK2 protein
  • Applications tips:
Description: A polyclonal antibody for detection of DYRK2 from Human, Mouse. This DYRK2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DYRK2 protein
Polyclonal DYRK2 Antibody
AMM06984G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 . This antibody is tested and proven to work in the following applications:
DYRK2 Polyclonal Antibody
ES8952-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
DYRK2 Polyclonal Antibody
ES8952-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
DYRK2 Polyclonal Antibody
ES10813-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
DYRK2 Polyclonal Antibody
ES10813-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against DYRK2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
DYRK2 Rabbit pAb
A7012-100ul 100 ul
EUR 308
DYRK2 Rabbit pAb
A7012-200ul 200 ul
EUR 459
DYRK2 Rabbit pAb
A7012-20ul 20 ul
EUR 183
DYRK2 Rabbit pAb
A7012-50ul 50 ul
EUR 223
DYRK2 Polyclonal Conjugated Antibody
C42670 100ul
EUR 397
DYRK2 Antibody
25289-100ul 100ul
EUR 390
DYRK2 Antibody
1-CSB-PA852896ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DYRK2. Recognizes DYRK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
DYRK2 Antibody
DF10136 200ul
EUR 304
Description: DYRK2 Antibody detects endogenous levels of total DYRK2.
DYRK2 Antibody
ABD10136 100 ug
EUR 438
Polyclonal DYRK2 Antibody (C-Terminus)
AMM06986G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (C-Terminus). This antibody is tested and proven to work in the following applications:
Polyclonal DYRK2 Antibody (N-term)
APR14269G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal Mouse Dyrk2 Antibody (C-term)
APR17418G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Dyrk2 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal DYRK2 antibody - C-terminal region
AMM06987G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DYRK2 - C-terminal region. This antibody is tested and proven to work in the following applications:
DYRK2/4 Antibody
DF10330 200ul
EUR 304
Description: DYRK2/4 Antibody detects endogenous levels of DYRK2/4.
Anti-DYRK2 antibody
STJ29092 100 µl
EUR 277
Description: DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert.
Anti-DYRK2 Antibody
STJ500807 100 µg
EUR 476
Anti-DYRK2 antibody
STJ190110 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK2
Anti-DYRK2 antibody
STJ191971 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to DYRK2
DYRK2 siRNA
20-abx914829
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
DYRK2 siRNA
20-abx914830
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Anti-DYRK2 Antibody (Biotin)
STJ500808 100 µg
EUR 586
Anti-DYRK2 Antibody (FITC)
STJ500809 100 µg
EUR 586
DYRK2/4 (Phospho-Tyr386/268) Polyclonal Conjugated Antibody
C12498 100ul
EUR 397
DYRK2 Blocking Peptide
DF10136-BP 1mg
EUR 195
DYRK2 cloning plasmid
CSB-CL852896HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1587
  • Sequence: atgaatgatcacctgcatgtcggcagccacgctcacggacagatccaggttcaacagttgtttgaggataacagtaacaagcggacagtgctcacgacacaaccaaatgggcttacaacagtgggcaaaacgggcttgccagtggtgccagagcggcagctggacagcattcata
  • Show more
Description: A cloning plasmid for the DYRK2 gene.
DYRK2 cloning plasmid
CSB-CL852896HU2-10ug 10ug
EUR 615
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1806
  • Sequence: atgttaaccaggaaaccttcggccgccgctcccgccgcctacccgaccggccgaggtggggacagcgccgttcgtcagcttcaggcttccccggggctcggtgcaggggccacccggagcggagtggggactggcccgccctcccccatcgccctgccgcctctccgggccagca
  • Show more
Description: A cloning plasmid for the DYRK2 gene.
pCDNA3.1-Dyrk2-m
PVT14259 2 ug
EUR 599
Anti-DYRK2 (2F9)
YF-MA11064 50 ug
EUR 363
Description: Mouse monoclonal to DYRK2
Anti-DYRK2 (3G5)
YF-MA16355 100 ug
EUR 363
Description: Mouse monoclonal to DYRK2
Anti-DYRK2 (6E2)
YF-MA16356 100 ug
EUR 363
Description: Mouse monoclonal to DYRK2
Anti-DYRK2 (4G11)
YF-MA16357 100 ug
EUR 363
Description: Mouse monoclonal to DYRK2
Anti-DYRK2 (2F9)
YF-MA16358 200 ul
EUR 363
Description: Mouse monoclonal to DYRK2
DYRK2 / 4 (pY386 / 268) Antibody
abx149950-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Monoclonal DYRK2 Antibody, Clone: 492CT4.2.4
AMM06985G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human DYRK2. The antibodies are raised in Mouse and are from clone 492CT4.2.4. This antibody is applicable in WB, E
DYRK2/4 Blocking Peptide
DF10330-BP 1mg
EUR 195
Chicken DYRK2 ELISA KIT
ELI-09351c 96 Tests
EUR 928
Human DYRK2 ELISA KIT
ELI-31566h 96 Tests
EUR 824

DYRK2 Rabbit Polyclonal Antibody

Back To Top