eEF2 antibody
To Order: garrett@bioworldantibodies.com
eEF2 Antibody |
AF7721 |
Affbiotech |
200ul |
EUR 376 |
Description: eEF2 Antibody detects endogenous levels of eEF2. |
EEF2 antibody |
70R-51523 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal EEF2 antibody |
EEF2 antibody |
70R-2318 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal EEF2 antibody raised against the N terminal of EEF2 |
eEF2 antibody |
70R-31022 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal eEF2 antibody |
EEF2 antibody |
10R-10728 |
Fitzgerald |
100 ug |
EUR 381 |
Description: Mouse monoclonal EEF2 antibody |
EEF2 antibody |
10R-11163 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Mouse Monoclonal EEF2 antibody |
EEF2 Antibody |
32582-100ul |
SAB |
100ul |
EUR 252 |
EEF2 antibody |
70R-17005 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EEF2 antibody |
EEF2 Antibody |
DF6798 |
Affbiotech |
200ul |
EUR 304 |
Description: EEF2 Antibody detects endogenous levels of total EEF2. |
EEF2 Antibody |
1-CSB-PA994433 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100 |
EEF2 Antibody |
1-CSB-PA002260 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000 |
EEF2 Antibody |
1-CSB-PA007434GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
EEF2 Antibody |
1-CSB-PA007434LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
EEF2 Antibody |
1-CSB-PA090786 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100 |
EEF2 Conjugated Antibody |
C32582 |
SAB |
100ul |
EUR 397 |
anti- EEF2 antibody |
FNab02651 |
FN Test |
100µg |
EUR 585 |
- Immunogen: eukaryotic translation elongation factor 2
- Uniprot ID: P13639
- Gene ID: 1938
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against EEF2 |
EEF2 (pT56) Antibody |
20-abx121387 |
Abbexa |
-
EUR 314.00
-
EUR 467.00
-
EUR 203.00
|
|
- Shipped within 5-10 working days.
|
eEF2 Polyclonal Antibody |
ABP58457-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein |
eEF2 Polyclonal Antibody |
ABP58457-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein |
eEF2 Polyclonal Antibody |
ABP58457-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein |
EEF2 Polyclonal Antibody |
A53432 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
eEF2 antibody (Thr56) |
70R-31021 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal eEF2 antibody (Thr56) |
EEF2 Monoclonal Antibody |
27102-100ul |
SAB |
100ul |
EUR 252 |
EEF2 Monoclonal Antibody |
27102-50ul |
SAB |
50ul |
EUR 187 |
Anti-eEF2 antibody |
STJ99607 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to eEF2. |
Anti-eEF2 antibody |
STJ99117 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Mouse monoclonal to eEF2. |
Anti-EEF2 antibody |
STJ23480 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. |
Anti-EEF2 antibody |
STJ114864 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. |
EEF2 siRNA |
20-abx901647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF2 siRNA |
20-abx914988 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF2 siRNA |
20-abx914989 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF2 Conjugated Monoclonal Antibody |
C27102 |
SAB |
100ul |
EUR 397 |
Phospho-eEF2 (Tyr443) Antibody |
AF7220 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-eEF2 (Tyr443) Antibody detects endogenous levels of eEF2 only when phosphorylated at Tyr443. |
Phospho-eEF2 (Thr57) Antibody |
AF7221 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-eEF2 (Thr57) Antibody detects endogenous levels of eEF2 only when phosphorylated at Thr57. |
EEF2 recombinant monoclonal antibody |
A5481 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human EEF2 for WB, IHC, IF,ELISA |
eEF2 (Phospho-Tyr443) Antibody |
13078-100ul |
SAB |
100ul |
EUR 252 |
eEF2 (Phospho-Tyr443) Antibody |
13078-50ul |
SAB |
50ul |
EUR 187 |
eEF2 (Phospho-Thr57) Antibody |
13079-100ul |
SAB |
100ul |
EUR 252 |
eEF2 (Phospho-Thr57) Antibody |
13079-50ul |
SAB |
50ul |
EUR 187 |
EEF2 Antibody, HRP conjugated |
1-CSB-PA007434LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EEF2 Antibody, FITC conjugated |
1-CSB-PA007434LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EEF2 Antibody, Biotin conjugated |
1-CSB-PA007434LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Phospho-EEF2 (T56) Antibody |
1-CSB-PA007904 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-EEF2 (T56). Recognizes Phospho-EEF2 (T56) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
Anti-EEF2 Monoclonal Antibody |
M00830-1 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal EEF2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
EEF2 Blocking Peptide |
BF0405-BP |
Affbiotech |
1mg |
EUR 195 |
eEF2 Blocking Peptide |
AF7720-BP |
Affbiotech |
1mg |
EUR 195 |
eEF2 Blocking Peptide |
AF7721-BP |
Affbiotech |
1mg |
EUR 195 |
EEF2 cloning plasmid |
CSB-CL007434HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2577
- Sequence: atggtgaacttcacggtagaccagatccgcgccatcatggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaagtccacgctgacagactccctggtgtgcaaggcgggcatcatcgcctcggcccgggccggggagacacgcttcactgata
- Show more
|
Description: A cloning plasmid for the EEF2 gene. |
EEF2 Blocking Peptide |
20-abx062098 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF2 Rabbit pAb |
A0099-100ul |
Abclonal |
100 ul |
EUR 308 |
EEF2 Rabbit pAb |
A0099-200ul |
Abclonal |
200 ul |
EUR 459 |
EEF2 Rabbit pAb |
A0099-20ul |
Abclonal |
20 ul |
EUR 183 |
EEF2 Rabbit pAb |
A0099-50ul |
Abclonal |
50 ul |
EUR 223 |
EEF2 Rabbit pAb |
A2068-100ul |
Abclonal |
100 ul |
EUR 308 |
EEF2 Rabbit pAb |
A2068-200ul |
Abclonal |
200 ul |
EUR 459 |
EEF2 Rabbit pAb |
A2068-20ul |
Abclonal |
20 ul |
EUR 183 |
EEF2 Rabbit pAb |
A2068-50ul |
Abclonal |
50 ul |
EUR 223 |
EEF2 Blocking Peptide |
33R-9020 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF2 antibody, catalog no. 70R-2318 |
EEF2 Blocking Peptide |
DF6798-BP |
Affbiotech |
1mg |
EUR 195 |
eEF2, Rabbit Reticulocytes |
P1316-10 |
Biovision |
|
EUR 370 |
anti-EEF2 (5B6) |
LF-MA30553 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to EEF2 |
Monoclonal EEF2 Antibody, Clone: 5B6 |
APR07656G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human EEF2. The antibodies are raised in Mouse and are from clone 5B6. This antibody is applicable in WB and IHC, ICC, E |
eEF2 (Phospho-Tyr443) Conjugated Antibody |
C13078 |
SAB |
100ul |
EUR 397 |
eEF2 (Phospho-Thr57) Conjugated Antibody |
C13079 |
SAB |
100ul |
EUR 397 |
eEF2 (Phospho-Thr56) Polyclonal Antibody |
ABP58456-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein |
eEF2 (Phospho-Thr56) Polyclonal Antibody |
ABP58456-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein |
eEF2 (Phospho-Thr56) Polyclonal Antibody |
ABP58456-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 Phospho-Thr56) from Human, Mouse, Rat. This eEF2 Phospho-Thr56) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 (Phospho-Thr56) Antibody protein |
EEF2 Polyclonal Antibody, Biotin Conjugated |
A53429 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
EEF2 Polyclonal Antibody, FITC Conjugated |
A53430 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
EEF2 Polyclonal Antibody, HRP Conjugated |
A53431 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Anti-Phospho-eEF2 (Thr56) antibody |
STJ99592 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Phospho-eEF2 (Thr56). |
Anti-Phospho-EEF2-T56 antibody |
STJ11100973 |
St John's Laboratory |
100 µl |
EUR 393 |
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. |
Anti-EEF2 Antibody (4B3-G7-H5) |
A1314-100 |
Biovision |
|
EUR 338 |
Rat EEF2 shRNA Plasmid |
20-abx985590 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EEF2 (pT56) Blocking Peptide |
20-abx162401 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human EEF2 shRNA Plasmid |
20-abx951337 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EEF2 protein (His tag) |
80R-3897 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant EEF2 protein (His tag) |
Mouse EEF2 shRNA Plasmid |
20-abx970115 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx112354 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx130986 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx109749 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx001685 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
abx159481-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
abx012012-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx007526 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx329583 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx214410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx214411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx270289 |
Abbexa |
-
EUR 495.00
-
EUR 578.00
-
EUR 286.00
-
EUR 885.00
-
EUR 370.00
|
-
100 tests
-
200 tests
-
25 tests
-
500 tests
-
50 tests
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
abx232651-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Phospho-EEF2-T56 Rabbit pAb |
AP0832-100ul |
Abclonal |
100 ul |
EUR 384 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-200ul |
Abclonal |
200 ul |
EUR 554 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-20ul |
Abclonal |
20 ul |
EUR 183 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-50ul |
Abclonal |
50 ul |
EUR 265 |
Phospho-eEF2 (Tyr443) Blocking Peptide |
AF7220-BP |
Affbiotech |
1mg |
EUR 195 |
Phospho-eEF2 (Thr57) Blocking Peptide |
AF7221-BP |
Affbiotech |
1mg |
EUR 195 |
Mouse Elongation factor 2 (Eef2) |
1-CSB-YP007434MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 97.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Elongation factor 2(Eef2) expressed in Yeast |
Human Elongation factor 2 (EEF2) |
1-CSB-EP007434HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 99.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Elongation factor 2(EEF2) expressed in E.coli |
Eef2 ORF Vector (Rat) (pORF) |
ORF066367 |
ABM |
1.0 ug DNA |
EUR 506 |
Eef2 ORF Vector (Mouse) (pORF) |
ORF043640 |
ABM |
1.0 ug DNA |
EUR 506 |
EEF2 ORF Vector (Human) (pORF) |
ORF012901 |
ABM |
1.0 ug DNA |
EUR 95 |
EEF2 ELISA Kit (Human) (OKEH04964) |
OKEH04964 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A-site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL |
EEF2 ELISA Kit (Rat) (OKEH05938) |
OKEH05938 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Catalyzes the GTP-dependent ribosomal translocation step during translation elongation. During this step, the ribosome changes from the pre-translocational (PRE) to the post-translocational (POST) state as the newly formed A-site-bound peptidyl-tRNA and P-site-bound deacylated tRNA move to the P and E sites, respectively. Catalyzes the coordinated movement of the two tRNA molecules, the mRNA and conformational changes in the ribosome. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.085 ng/mL |
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (HRP) |
20-abx108211 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (Biotin) |
20-abx105373 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody (FITC) |
20-abx106792 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
eEF2 Colorimetric Cell-Based ELISA Kit |
EKC1180 |
BosterBio |
100ul |
EUR 572 |
EEF2 sgRNA CRISPR Lentivector set (Human) |
K0657801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eef2 sgRNA CRISPR Lentivector set (Mouse) |
K3928501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eef2 sgRNA CRISPR Lentivector set (Rat) |
K6785201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Eukaryotic Translation Elongation Factor 2 (EEF2) Polyclonal Antibody (Human) |
4-PAC453Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EEF2 (Lys32~Val233)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Eukaryotic Translation Elongation Factor 2 (EEF2) |
Cow Elongation Factor 2 (EEF2) ELISA Kit |
abx521279-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Chicken Elongation Factor 2 (EEF2) ELISA Kit |
abx521280-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Elongation Factor 2 (EEF2) ELISA Kit |
abx521281-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Rat Elongation Factor 2 (EEF2) ELISA Kit |
abx521283-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Mouse Eef2/ Elongation factor 2 ELISA Kit |
E0450Mo |
Sunlong |
1 Kit |
EUR 632 |
Rat Eef2/ Elongation factor 2 ELISA Kit |
E0319Ra |
Sunlong |
1 Kit |
EUR 646 |
Human EEF2/ Elongation factor 2 ELISA Kit |
E0763Hu |
Sunlong |
1 Kit |
EUR 605 |
Rabbit Elongation factor 2, EEF2 ELISA KIT |
ELI-26044Ra |
Lifescience Market |
96 Tests |
EUR 928 |
Chicken Elongation factor 2, EEF2 ELISA KIT |
ELI-09302c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Eef2(Elongation factor 2) ELISA Kit |
EM0821 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P58252
- Alias: Eef2/EF-2/EF2EEF-2/elongation factor 2/eukaryotic translation elongation factor 2/polypeptidyl-tRNA translocase
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml |
EEF2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0657802 |
ABM |
1.0 ug DNA |
EUR 154 |
EEF2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0657803 |
ABM |
1.0 ug DNA |
EUR 154 |
EEF2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0657804 |
ABM |
1.0 ug DNA |
EUR 154 |
Eukaryotic Translation Elongation Factor 2 (EEF2) Protein |
20-abx261366 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Mouse Elongation Factor 2 (EEF2) ELISA Kit |
abx255169-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human elongation factor 2(eEF2) ELISA Kit |
CSB-E13572h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human elongation factor 2 (eEF2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human elongation factor 2(eEF2) ELISA Kit |
1-CSB-E13572h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human elongation factor 2(eEF2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3928502 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3928503 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3928504 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6785202 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6785203 |
ABM |
1.0 ug DNA |
EUR 154 |
Eef2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6785204 |
ABM |
1.0 ug DNA |
EUR 154 |
EEF2 Protein Vector (Human) (pPB-C-His) |
PV051601 |
ABM |
500 ng |
EUR 481 |
EEF2 Protein Vector (Human) (pPB-N-His) |
PV051602 |
ABM |
500 ng |
EUR 481 |
EEF2 Protein Vector (Human) (pPM-C-HA) |
PV051603 |
ABM |
500 ng |
EUR 481 |
EEF2 Protein Vector (Human) (pPM-C-His) |
PV051604 |
ABM |
500 ng |
EUR 481 |
Recombinant Eukaryotic Translation Elongation Factor 2 (EEF2) |
4-RPC453Hu01 |
Cloud-Clone |
-
EUR 350.88
-
EUR 197.00
-
EUR 1040.80
-
EUR 413.60
-
EUR 727.20
-
EUR 298.00
-
EUR 2452.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P13639
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Eukaryotic Translation Elongation Factor 2 expressed in: E.coli |
EEF2 Protein Vector (Mouse) (pPB-C-His) |
PV174558 |
ABM |
500 ng |
EUR 1065 |
EEF2 Protein Vector (Mouse) (pPB-N-His) |
PV174559 |
ABM |
500 ng |
EUR 1065 |
EEF2 Protein Vector (Mouse) (pPM-C-HA) |
PV174560 |
ABM |
500 ng |
EUR 1065 |
EEF2 Protein Vector (Mouse) (pPM-C-His) |
PV174561 |
ABM |
500 ng |
EUR 1065 |
EEF2 Protein Vector (Rat) (pPB-C-His) |
PV265466 |
ABM |
500 ng |
EUR 1166 |
EEF2 Protein Vector (Rat) (pPB-N-His) |
PV265467 |
ABM |
500 ng |
EUR 1166 |
EEF2 Protein Vector (Rat) (pPM-C-HA) |
PV265468 |
ABM |
500 ng |
EUR 1166 |
eEF2 antibody