eEF2 (Phospho-Thr56) Antibody
To Order: garrett@bioworldantibodies.com
Anti-Phospho-eEF2 (Thr56) antibody |
STJ99592 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Phospho-eEF2 (Thr56). |
eEF2 antibody (Thr56) |
70R-31021 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal eEF2 antibody (Thr56) |
eEF2 (Phospho-Thr56) Colorimetric Cell-Based ELISA Kit |
EKC1985 |
BosterBio |
100ul |
EUR 572 |
Eukaryotic Translation Elongation Factor 2 Phospho-Thr56 (EEF2 pT56) Antibody |
20-abx329168 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-eEF2 (Thr56) Colorimetric Cell-Based ELISA Kit (OKAG01510) |
OKAG01510 |
Aviva Systems Biology |
2 x 96 Wells |
EUR 740 |
Description: Description of target: ;Species reactivity: Human: T56, Mouse: T56, Rat: T56;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: Phospho Detection Method: Colorimetric 450 nm;Sensitivity: |
Phospho-BCL2 (Thr56) Antibody |
CSB-PA206782- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
- Show more
|
Description: A polyclonal antibody against Phospho-BCL2 (Thr56). Recognizes Phospho-BCL2 (Thr56) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
Phospho-BCL2 (Thr56) Antibody |
CSB-PA206782-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
- Show more
|
Description: A polyclonal antibody against Phospho-BCL2 (Thr56). Recognizes Phospho-BCL2 (Thr56) from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
Phospho-Bim (Thr56/116) Antibody |
AF8247 |
Affbiotech |
200ul |
EUR 376 |
Description: Bim (Phospho-Thr56/116) Antibody detects endogenous levels of Bim only when phosphorylated at Thr56/116. |
Phospho-Bcl-2 (Thr56) Antibody |
AF4400 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-Bcl-2 (Thr56) Antibody detects endogenous levels of Bcl-2 only when phosphorylated at Thr56. |
Phospho-Bcl-2 (Thr56) antibody |
A1012-100 |
Biovision |
|
EUR 359 |
Bim (Phospho-Thr56/116) Antibody |
12579-100ul |
SAB |
100ul |
EUR 252 |
Bim (Phospho-Thr56/116) Antibody |
12579-50ul |
SAB |
50ul |
EUR 187 |
BCL-2(Phospho-Thr56) Antibody |
11064-100ul |
SAB |
100ul |
EUR 252 |
BCL-2(Phospho-Thr56) Antibody |
11064-50ul |
SAB |
50ul |
EUR 187 |
Phospho-eEF2 (Tyr443) Antibody |
AF7220 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-eEF2 (Tyr443) Antibody detects endogenous levels of eEF2 only when phosphorylated at Tyr443. |
Phospho-eEF2 (Thr57) Antibody |
AF7221 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-eEF2 (Thr57) Antibody detects endogenous levels of eEF2 only when phosphorylated at Thr57. |
eEF2 (Phospho-Tyr443) Antibody |
13078-100ul |
SAB |
100ul |
EUR 252 |
eEF2 (Phospho-Tyr443) Antibody |
13078-50ul |
SAB |
50ul |
EUR 187 |
eEF2 (Phospho-Thr57) Antibody |
13079-100ul |
SAB |
100ul |
EUR 252 |
eEF2 (Phospho-Thr57) Antibody |
13079-50ul |
SAB |
50ul |
EUR 187 |
Phospho-EEF2 (T56) Antibody |
1-CSB-PA007904 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-EEF2 (T56). Recognizes Phospho-EEF2 (T56) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000 |
Polyclonal Phospho-Bcl-2 (Thr56) antibody |
APR09150G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-Bcl-2 (Thr56) . This antibody is tested and proven to work in the following applications: |
Bcl-2 (phospho Thr56) Polyclonal Antibody |
ES1273-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Bcl-2 (phospho Thr56) from Human. This antibody is tested and validated for WB, ELISA, IHC, IP, IF, WB, ELISA |
Bcl-2 (phospho Thr56) Polyclonal Antibody |
ES1273-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Bcl-2 (phospho Thr56) from Human. This antibody is tested and validated for WB, ELISA, IHC, IP, IF, WB, ELISA |
EF-2 (phospho Thr56) Polyclonal Antibody |
ES5044-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against EF-2 (phospho Thr56) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
EF-2 (phospho Thr56) Polyclonal Antibody |
ES5044-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against EF-2 (phospho Thr56) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA |
Bcl-2 (phospho Thr56) Polyclonal Antibody |
ABP50274-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human Bcl-2 around the phosphorylation site of T56
- Applications tips:
|
Description: A polyclonal antibody for detection of Bcl-2 phospho Thr56) from Human. This Bcl-2 phospho Thr56) antibody is for WB, IHC-P, IP, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Bcl-2 around the phosphorylation site of T56 |
Bcl-2 (phospho Thr56) Polyclonal Antibody |
ABP50274-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human Bcl-2 around the phosphorylation site of T56
- Applications tips:
|
Description: A polyclonal antibody for detection of Bcl-2 phospho Thr56) from Human. This Bcl-2 phospho Thr56) antibody is for WB, IHC-P, IP, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Bcl-2 around the phosphorylation site of T56 |
Bcl-2 (phospho Thr56) Polyclonal Antibody |
ABP50274-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human Bcl-2 around the phosphorylation site of T56
- Applications tips:
|
Description: A polyclonal antibody for detection of Bcl-2 phospho Thr56) from Human. This Bcl-2 phospho Thr56) antibody is for WB, IHC-P, IP, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Bcl-2 around the phosphorylation site of T56 |
EF-2 (phospho Thr56) Polyclonal Antibody |
ABP54045-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human EF-2 around the phosphorylation site of T56
- Applications tips:
|
Description: A polyclonal antibody for detection of EF-2 phospho Thr56) from Human, Mouse, Rat. This EF-2 phospho Thr56) antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EF-2 around the phosphorylation site of T56 |
EF-2 (phospho Thr56) Polyclonal Antibody |
ABP54045-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human EF-2 around the phosphorylation site of T56
- Applications tips:
|
Description: A polyclonal antibody for detection of EF-2 phospho Thr56) from Human, Mouse, Rat. This EF-2 phospho Thr56) antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EF-2 around the phosphorylation site of T56 |
EF-2 (phospho Thr56) Polyclonal Antibody |
ABP54045-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human EF-2 around the phosphorylation site of T56
- Applications tips:
|
Description: A polyclonal antibody for detection of EF-2 phospho Thr56) from Human, Mouse, Rat. This EF-2 phospho Thr56) antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human EF-2 around the phosphorylation site of T56 |
EF-2 (Phospho-Thr56) Polyclonal Antibody |
12351-100ul |
SAB |
100ul |
EUR 252 |
EF-2 (Phospho-Thr56) Polyclonal Antibody |
12351-50ul |
SAB |
50ul |
EUR 187 |
anti-BCL-2 (Phospho-Thr56) |
LF-PA20049 |
Abfrontier |
100 ul |
EUR 354 |
Description: Rabbit polyclonal to BCL-2 (Phospho-Thr56) |
eEF2 (Phospho-Tyr443) Conjugated Antibody |
C13078 |
SAB |
100ul |
EUR 397 |
eEF2 (Phospho-Thr57) Conjugated Antibody |
C13079 |
SAB |
100ul |
EUR 397 |
Anti-Phospho-EEF2-T56 antibody |
STJ11100973 |
St John's Laboratory |
100 µl |
EUR 393 |
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. |
BCL-2(Phospho-Thr56) Polyclonal Conjugated Antibody |
C11064 |
SAB |
100ul |
EUR 397 |
Bim (Phospho-Thr56/116) Polyclonal Conjugated Antibody |
C12579 |
SAB |
100ul |
EUR 397 |
Phospho-Bim (Thr56/116) Blocking Peptide |
AF8247-BP |
Affbiotech |
1mg |
EUR 195 |
Phospho-Bcl-2 (Thr56) Blocking Peptide |
AF4400-BP |
Affbiotech |
1mg |
EUR 195 |
BCL2 antibody (Thr56) |
70R-36053 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal BCL2 antibody (Thr56) |
BCL2 antibody (Thr56) |
70R-37145 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Rabbit Polyclonal BCL2 antibody (Thr56) |
EF-2 (Phospho-Thr56) Polyclonal Polyclonal Conjugated Antibody |
C12351 |
SAB |
100ul |
EUR 397 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-100ul |
Abclonal |
100 ul |
EUR 384 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-200ul |
Abclonal |
200 ul |
EUR 554 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-20ul |
Abclonal |
20 ul |
EUR 183 |
Phospho-EEF2-T56 Rabbit pAb |
AP0832-50ul |
Abclonal |
50 ul |
EUR 265 |
Phospho-eEF2 (Tyr443) Blocking Peptide |
AF7220-BP |
Affbiotech |
1mg |
EUR 195 |
Phospho-eEF2 (Thr57) Blocking Peptide |
AF7221-BP |
Affbiotech |
1mg |
EUR 195 |
EEF2 Antibody |
BF0405 |
Affbiotech |
200ul |
EUR 376 |
Description: EEF2 antibody detects endogenous levels of total EEF2. |
eEF2 Antibody |
AF7720 |
Affbiotech |
200ul |
EUR 376 |
Description: eEF2 Antibody detects endogenous levels of eEF2. |
eEF2 Antibody |
AF7721 |
Affbiotech |
200ul |
EUR 376 |
Description: eEF2 Antibody detects endogenous levels of eEF2. |
EEF2 antibody |
70R-51523 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal EEF2 antibody |
EEF2 antibody |
70R-2318 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal EEF2 antibody raised against the N terminal of EEF2 |
eEF2 antibody |
70R-31022 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit polyclonal eEF2 antibody |
EEF2 antibody |
10R-10728 |
Fitzgerald |
100 ug |
EUR 381 |
Description: Mouse monoclonal EEF2 antibody |
EEF2 antibody |
10R-11163 |
Fitzgerald |
100 ug |
EUR 349 |
Description: Mouse Monoclonal EEF2 antibody |
EEF2 Antibody |
32582-100ul |
SAB |
100ul |
EUR 252 |
EEF2 antibody |
70R-17005 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EEF2 antibody |
EEF2 Antibody |
DF6798 |
Affbiotech |
200ul |
EUR 304 |
Description: EEF2 Antibody detects endogenous levels of total EEF2. |
EEF2 Antibody |
1-CSB-PA994433 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100 |
EEF2 Antibody |
1-CSB-PA002260 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000 |
EEF2 Antibody |
1-CSB-PA007434GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
EEF2 Antibody |
1-CSB-PA007434LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
EEF2 Antibody |
1-CSB-PA090786 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:500-1:2000, IHC:1:25-1:100 |
EEF2 Conjugated Antibody |
C32582 |
SAB |
100ul |
EUR 397 |
anti- EEF2 antibody |
FNab02651 |
FN Test |
100µg |
EUR 585 |
- Immunogen: eukaryotic translation elongation factor 2
- Uniprot ID: P13639
- Gene ID: 1938
- Research Area: Cardiovascular, Metabolism
|
Description: Antibody raised against EEF2 |
EEF2 (pT56) Antibody |
20-abx121387 |
Abbexa |
-
EUR 314.00
-
EUR 467.00
-
EUR 203.00
|
|
- Shipped within 5-10 working days.
|
eEF2 Polyclonal Antibody |
ABP58457-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein |
eEF2 Polyclonal Antibody |
ABP58457-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein |
eEF2 Polyclonal Antibody |
ABP58457-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human eEF2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of eEF2 from Human, Mouse, Rat. This eEF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human eEF2 antibody protein |
EEF2 Polyclonal Antibody |
A53432 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
EEF2 Monoclonal Antibody |
27102-100ul |
SAB |
100ul |
EUR 252 |
EEF2 Monoclonal Antibody |
27102-50ul |
SAB |
50ul |
EUR 187 |
Anti-eEF2 antibody |
STJ99607 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to eEF2. |
Anti-eEF2 antibody |
STJ99117 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Mouse monoclonal to eEF2. |
Anti-EEF2 antibody |
STJ23480 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. |
Anti-EEF2 antibody |
STJ114864 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. |
B-Cell Leukemia/Lymphoma 2 Phospho-Thr56 (BCL2 pT56) Antibody |
20-abx324962 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
B-Cell Leukemia/Lymphoma 2 Phospho-Thr56 (BCL2 pT56) Antibody |
abx332859-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
BCL-2 (Phospho-Thr56) Colorimetric Cell-Based ELISA Kit |
EKC2363 |
BosterBio |
100ul |
EUR 572 |
EEF2 siRNA |
20-abx901647 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF2 siRNA |
20-abx914988 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF2 siRNA |
20-abx914989 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF2 Conjugated Monoclonal Antibody |
C27102 |
SAB |
100ul |
EUR 397 |
EEF2 recombinant monoclonal antibody |
A5481 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human EEF2 for WB, IHC, IF,ELISA |
EEF2 Antibody, HRP conjugated |
1-CSB-PA007434LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EEF2 Antibody, FITC conjugated |
1-CSB-PA007434LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EEF2 Antibody, Biotin conjugated |
1-CSB-PA007434LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EEF2. Recognizes EEF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-EEF2 Monoclonal Antibody |
M00830-1 |
BosterBio |
100ug |
EUR 397 |
Description: Rabbit Monoclonal EEF2 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
Phospho-BCL-2 (Thr56) Colorimetric Cell-Based ELISA Kit (OKAG01897) |
OKAG01897 |
Aviva Systems Biology |
2 x 96 Wells |
EUR 740 |
Description: Description of target: ;Species reactivity: Human: T56;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: Phospho Detection Method: Colorimetric 450 nm;Sensitivity: |
EEF2 Blocking Peptide |
BF0405-BP |
Affbiotech |
1mg |
EUR 195 |
eEF2 Blocking Peptide |
AF7720-BP |
Affbiotech |
1mg |
EUR 195 |
eEF2 Blocking Peptide |
AF7721-BP |
Affbiotech |
1mg |
EUR 195 |
EEF2 cloning plasmid |
CSB-CL007434HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2577
- Sequence: atggtgaacttcacggtagaccagatccgcgccatcatggacaagaaggccaacatccgcaacatgtctgtcatcgcccacgtggaccatggcaagtccacgctgacagactccctggtgtgcaaggcgggcatcatcgcctcggcccgggccggggagacacgcttcactgata
- Show more
|
Description: A cloning plasmid for the EEF2 gene. |
EEF2 Blocking Peptide |
20-abx062098 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EEF2 Rabbit pAb |
A0099-100ul |
Abclonal |
100 ul |
EUR 308 |
EEF2 Rabbit pAb |
A0099-200ul |
Abclonal |
200 ul |
EUR 459 |
EEF2 Rabbit pAb |
A0099-20ul |
Abclonal |
20 ul |
EUR 183 |
EEF2 Rabbit pAb |
A0099-50ul |
Abclonal |
50 ul |
EUR 223 |
EEF2 Rabbit pAb |
A2068-100ul |
Abclonal |
100 ul |
EUR 308 |
EEF2 Rabbit pAb |
A2068-200ul |
Abclonal |
200 ul |
EUR 459 |
EEF2 Rabbit pAb |
A2068-20ul |
Abclonal |
20 ul |
EUR 183 |
EEF2 Rabbit pAb |
A2068-50ul |
Abclonal |
50 ul |
EUR 223 |
EEF2 Blocking Peptide |
33R-9020 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EEF2 antibody, catalog no. 70R-2318 |
EEF2 Blocking Peptide |
DF6798-BP |
Affbiotech |
1mg |
EUR 195 |
eEF2, Rabbit Reticulocytes |
P1316-10 |
Biovision |
|
EUR 370 |
anti-EEF2 (5B6) |
LF-MA30553 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to EEF2 |
Monoclonal EEF2 Antibody, Clone: 5B6 |
APR07656G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human EEF2. The antibodies are raised in Mouse and are from clone 5B6. This antibody is applicable in WB and IHC, ICC, E |
EEF2 Polyclonal Antibody, Biotin Conjugated |
A53429 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
EEF2 Polyclonal Antibody, FITC Conjugated |
A53430 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
EEF2 Polyclonal Antibody, HRP Conjugated |
A53431 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Anti-EEF2 Antibody (4B3-G7-H5) |
A1314-100 |
Biovision |
|
EUR 338 |
Rat EEF2 shRNA Plasmid |
20-abx985590 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EEF2 (pT56) Blocking Peptide |
20-abx162401 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human EEF2 shRNA Plasmid |
20-abx951337 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EEF2 protein (His tag) |
80R-3897 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Purified recombinant EEF2 protein (His tag) |
Mouse EEF2 shRNA Plasmid |
20-abx970115 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx112354 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx130986 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx109749 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx001685 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
abx159481-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
abx012012-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx007526 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx329583 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx214410 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx214411 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
20-abx270289 |
Abbexa |
-
EUR 495.00
-
EUR 578.00
-
EUR 286.00
-
EUR 885.00
-
EUR 370.00
|
-
100 tests
-
200 tests
-
25 tests
-
500 tests
-
50 tests
|
- Shipped within 5-7 working days.
|
Eukaryotic Translation Elongation Factor 2 (EEF2) Antibody |
abx232651-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Mouse Elongation factor 2 (Eef2) |
1-CSB-YP007434MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 97.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Elongation factor 2(Eef2) expressed in Yeast |
Human Elongation factor 2 (EEF2) |
1-CSB-EP007434HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 99.2 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Elongation factor 2(EEF2) expressed in E.coli |
Eef2 ORF Vector (Rat) (pORF) |
ORF066367 |
ABM |
1.0 ug DNA |
EUR 506 |
eEF2 (Phospho-Thr56) Antibody