EGR2 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
EGR2 Polyclonal Antibody |
ABP58464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human EGR2 protein at amino acid sequence of 340-420
- Applications tips:
|
Description: A polyclonal antibody for detection of EGR2 from Human, Mouse, Rat. This EGR2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EGR2 protein at amino acid sequence of 340-420 |
EGR2 Rabbit pAb |
A15052-100ul |
Abclonal |
100 ul |
EUR 308 |
EGR2 Rabbit pAb |
A15052-200ul |
Abclonal |
200 ul |
EUR 459 |
EGR2 Rabbit pAb |
A15052-20ul |
Abclonal |
20 ul |
EUR 183 |
EGR2 Rabbit pAb |
A15052-50ul |
Abclonal |
50 ul |
EUR 223 |
EGR2 Rabbit pAb |
A15053-100ul |
Abclonal |
100 ul |
EUR 308 |
EGR2 Rabbit pAb |
A15053-200ul |
Abclonal |
200 ul |
EUR 459 |
EGR2 Rabbit pAb |
A15053-20ul |
Abclonal |
20 ul |
EUR 183 |
EGR2 Rabbit pAb |
A15053-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal EGR2 Antibody (Internal) |
APG03267G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EGR2 (Internal). This antibody is tested and proven to work in the following applications: |
EGR2 Antibody |
AF0480 |
Affbiotech |
200ul |
EUR 304 |
Description: EGR2 Antibody detects endogenous levels of EGR2. |
EGR2 Antibody |
33670-100ul |
SAB |
100ul |
EUR 252 |
EGR2 Antibody |
33670-50ul |
SAB |
50ul |
EUR 187 |
EGR2 Antibody |
49927-100ul |
SAB |
100ul |
EUR 333 |
EGR2 Antibody |
49927-50ul |
SAB |
50ul |
EUR 239 |
EGR2 Antibody |
43313-100ul |
SAB |
100ul |
EUR 252 |
EGR2 antibody |
70R-17022 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal EGR2 antibody |
EGR2 Antibody |
CSB-PA891042- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against EGR2. Recognizes EGR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
EGR2 Antibody |
CSB-PA891042-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against EGR2. Recognizes EGR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
EGR2 Antibody |
1-CSB-PA007485GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against EGR2. Recognizes EGR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
EGR2 Antibody |
1-CSB-PA007485LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EGR2. Recognizes EGR2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200 |
Rabbit EGR2 ELISA Kit |
ERTE0051 |
Abclonal |
96Tests |
EUR 521 |
Polyclonal Goat Anti-EGR2 Antibody |
APR12091G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-EGR2 . This antibody is tested and proven to work in the following applications: |
EGR2 Conjugated Antibody |
C43313 |
SAB |
100ul |
EUR 397 |
EGR2 Conjugated Antibody |
C49927 |
SAB |
100ul |
EUR 397 |
EGR2 Conjugated Antibody |
C33670 |
SAB |
100ul |
EUR 397 |
anti- EGR2 antibody |
FNab02672 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: early growth response 2(Krox-20 homolog, Drosophila)
- Uniprot ID: P11161
- Gene ID: 1959
- Research Area: Metabolism, Developmental biology
|
Description: Antibody raised against EGR2 |
EGR1 / EGR2 Antibody |
20-abx329369 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGR1 / EGR2 Antibody |
abx332619-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
EGR1/EGR2 Antibody |
1-CSB-PA002285 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against EGR1/EGR2. Recognizes EGR1/EGR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
EGR1/EGR2 Antibody |
CSB-PA253458- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against EGR1/EGR2. Recognizes EGR1/EGR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
EGR1/EGR2 Antibody |
CSB-PA253458-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against EGR1/EGR2. Recognizes EGR1/EGR2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000 |
Anti-EGR2 Antibody |
PA2178 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-EGR2 antibody |
STJ117246 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a transcription factor with three tandem C2H2-type zinc fingers. Defects in this gene are associated with Charcot-Marie-Tooth disease type 1D (CMT1D), Charcot-Marie-Tooth disease type 4E (CMT4E), and with Dejerine-Sottas syndrome (DSS). Multiple transcript variants encoding two different isoforms have been found for this gene. |
Anti-EGR2 antibody |
STJ117247 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a transcription factor with three tandem C2H2-type zinc fingers. Defects in this gene are associated with Charcot-Marie-Tooth disease type 1D (CMT1D), Charcot-Marie-Tooth disease type 4E (CMT4E), and with Dejerine-Sottas syndrome (DSS). Multiple transcript variants encoding two different isoforms have been found for this gene. |
Anti-EGR2 antibody |
STJ190192 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to EGR2 |
EGR2 siRNA |
20-abx901661 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGR2 siRNA |
20-abx915083 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EGR2 siRNA |
20-abx915084 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-EGR2 |
YF-PA11508 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to EGR2 |
anti-EGR2 |
YF-PA11509 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to EGR2 |
anti-EGR2 |
YF-PA11510 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to EGR2 |
anti-EGR2 |
YF-PA11511 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to EGR2 |
EGR2 Antibody, HRP conjugated |
1-CSB-PA007485LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EGR2. Recognizes EGR2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
EGR2 Antibody, FITC conjugated |
1-CSB-PA007485LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EGR2. Recognizes EGR2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
EGR2 Antibody, Biotin conjugated |
1-CSB-PA007485LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against EGR2. Recognizes EGR2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
EGR2 Blocking Peptide |
AF0480-BP |
Affbiotech |
1mg |
EUR 195 |
EGR2 cloning plasmid |
CSB-CL007485HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1500
- Sequence: atgatgaccgccaaggccgtagacaaaatcccagtaactctcagtggttttgtgcaccagctgtctgacaacatctacccggtggaggacctcgccgccacgtcggtgaccatctttcccaatgccgaactgggaggcccctttgaccagatgaacggagtggccggagatggca
- Show more
|
Description: A cloning plasmid for the EGR2 gene. |
Anti-EGR2 (1G5) |
YF-MA12795 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to EGR2 |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Mouse) |
4-PAB451Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly150~Ser407)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Early Growth Response Protein 2 (EGR2) |
Rabbit Early Growth Response 2 (EGR2) ELISA Kit |
abx363211-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Early Growth Response 2 (EGR2) Antibody |
20-abx112224 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Early Growth Response 2 (EGR2) Antibody |
abx122810-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Early Growth Response 2 (EGR2) Antibody |
20-abx013382 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
Early Growth Response 2 (EGR2) Antibody |
20-abx318834 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Early Growth Response 2 (EGR2) Antibody |
abx431225-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Early Growth Response 2 (EGR2) Antibody |
abx232672-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Human, Pig) |
4-PAB451Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly147~Cys403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Early Growth Response Protein 2 (EGR2) |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Mouse), APC |
4-PAB451Mu01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly150~Ser407)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Early Growth Response Protein 2 (EGR2). This antibody is labeled with APC. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Mouse), Biotinylated |
4-PAB451Mu01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly150~Ser407)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Early Growth Response Protein 2 (EGR2). This antibody is labeled with Biotin. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Mouse), Cy3 |
4-PAB451Mu01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly150~Ser407)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Early Growth Response Protein 2 (EGR2). This antibody is labeled with Cy3. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Mouse), FITC |
4-PAB451Mu01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly150~Ser407)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Early Growth Response Protein 2 (EGR2). This antibody is labeled with FITC. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Mouse), HRP |
4-PAB451Mu01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly150~Ser407)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Early Growth Response Protein 2 (EGR2). This antibody is labeled with HRP. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Mouse), PE |
4-PAB451Mu01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly150~Ser407)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Early Growth Response Protein 2 (EGR2). This antibody is labeled with PE. |
Rat EGR2 shRNA Plasmid |
20-abx987152 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human EGR2 ELISA Kit |
EHE0051 |
Abclonal |
96Tests |
EUR 521 |
Goat EGR2 ELISA Kit |
EGTE0051 |
Abclonal |
96Tests |
EUR 521 |
Canine EGR2 ELISA Kit |
ECE0051 |
Abclonal |
96Tests |
EUR 521 |
Chicken EGR2 ELISA Kit |
ECKE0051 |
Abclonal |
96Tests |
EUR 521 |
Bovine EGR2 ELISA Kit |
EBE0051 |
Abclonal |
96Tests |
EUR 521 |
Anserini EGR2 ELISA Kit |
EAE0051 |
Abclonal |
96Tests |
EUR 521 |
Porcine EGR2 ELISA Kit |
EPE0051 |
Abclonal |
96Tests |
EUR 521 |
Rat EGR2 ELISA Kit |
ERE0051 |
Abclonal |
96Tests |
EUR 521 |
Sheep EGR2 ELISA Kit |
ESE0051 |
Abclonal |
96Tests |
EUR 521 |
Mouse EGR2 ELISA Kit |
EME0051 |
Abclonal |
96Tests |
EUR 521 |
Monkey EGR2 ELISA Kit |
EMKE0051 |
Abclonal |
96Tests |
EUR 521 |
Human EGR2 shRNA Plasmid |
20-abx951355 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse EGR2 shRNA Plasmid |
20-abx970133 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
EGR2 Recombinant Protein (Human) |
RP010312 |
ABM |
100 ug |
Ask for price |
EGR2 Recombinant Protein (Rat) |
RP199223 |
ABM |
100 ug |
Ask for price |
EGR2 Recombinant Protein (Mouse) |
RP131099 |
ABM |
100 ug |
Ask for price |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Human, Pig), APC |
4-PAB451Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly147~Cys403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Early Growth Response Protein 2 (EGR2). This antibody is labeled with APC. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Human, Pig), Biotinylated |
4-PAB451Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly147~Cys403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Early Growth Response Protein 2 (EGR2). This antibody is labeled with Biotin. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Human, Pig), Cy3 |
4-PAB451Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly147~Cys403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Early Growth Response Protein 2 (EGR2). This antibody is labeled with Cy3. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Human, Pig), FITC |
4-PAB451Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly147~Cys403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Early Growth Response Protein 2 (EGR2). This antibody is labeled with FITC. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Human, Pig), HRP |
4-PAB451Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly147~Cys403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Early Growth Response Protein 2 (EGR2). This antibody is labeled with HRP. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Human, Pig), PE |
4-PAB451Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly147~Cys403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Early Growth Response Protein 2 (EGR2). This antibody is labeled with PE. |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAB451Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly150~Ser407)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Early Growth Response Protein 2 (EGR2). This antibody is labeled with APC-Cy7. |
Early Growth Response Protein 2 (EGR2) Antibody |
20-abx103235 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Early Growth Response Protein 2 (EGR2) Antibody |
20-abx104965 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Early Growth Response Protein 2 (EGR2) Antibody |
abx332530-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Early Growth Response 2 (EGR2) Antibody (HRP) |
20-abx316854 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Early Growth Response 2 (EGR2) Antibody (FITC) |
20-abx316855 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Early Growth Response 2 (EGR2) Antibody (Biotin) |
20-abx316856 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Guinea Pig EGR2 ELISA Kit |
EGE0051 |
Abclonal |
96Tests |
EUR 521 |
EGR2 ORF Vector (Human) (pORF) |
ORF003438 |
ABM |
1.0 ug DNA |
EUR 95 |
Egr2 ORF Vector (Rat) (pORF) |
ORF066409 |
ABM |
1.0 ug DNA |
EUR 506 |
Egr2 ORF Vector (Mouse) (pORF) |
ORF043701 |
ABM |
1.0 ug DNA |
EUR 506 |
EGR2 ELISA Kit (Rat) (OKEI00759) |
OKEI00759 |
Aviva Systems Biology |
96 Wells |
EUR 767 |
Description: Description of target: Sequence-specific DNA-binding transcription factor. Binds to two specific DNA sites located in the promoter region of HOXA4. Binds to the promoter region of ERBB2.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL |
Early Growth Response Protein 2 (EGR2) Polyclonal Antibody (Human, Pig), APC-Cy7 |
4-PAB451Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: EGR2 (Gly147~Cys403)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Pig Early Growth Response Protein 2 (EGR2). This antibody is labeled with APC-Cy7. |
EGR2 sgRNA CRISPR Lentivector set (Human) |
K0005901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Egr2 sgRNA CRISPR Lentivector set (Mouse) |
K4425101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Egr2 sgRNA CRISPR Lentivector set (Rat) |
K7077301 |
ABM |
3 x 1.0 ug |
EUR 339 |
EGR2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0005902 |
ABM |
1.0 ug DNA |
EUR 154 |
EGR2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0005903 |
ABM |
1.0 ug DNA |
EUR 154 |
EGR2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0005904 |
ABM |
1.0 ug DNA |
EUR 154 |
Egr2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4425102 |
ABM |
1.0 ug DNA |
EUR 154 |
Egr2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4425103 |
ABM |
1.0 ug DNA |
EUR 154 |
Egr2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4425104 |
ABM |
1.0 ug DNA |
EUR 154 |
Egr2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7077302 |
ABM |
1.0 ug DNA |
EUR 154 |
Egr2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7077303 |
ABM |
1.0 ug DNA |
EUR 154 |
Egr2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7077304 |
ABM |
1.0 ug DNA |
EUR 154 |
EGR2 Protein Vector (Mouse) (pPB-C-His) |
PV174802 |
ABM |
500 ng |
EUR 603 |
EGR2 Protein Vector (Mouse) (pPB-N-His) |
PV174803 |
ABM |
500 ng |
EUR 603 |
EGR2 Protein Vector (Mouse) (pPM-C-HA) |
PV174804 |
ABM |
500 ng |
EUR 603 |
EGR2 Protein Vector (Mouse) (pPM-C-His) |
PV174805 |
ABM |
500 ng |
EUR 603 |
Recombinant Early Growth Response Protein 2 (EGR2) |
4-RPB451Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P11161
- Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.3kDa
- Isoelectric Point: 9.1
|
Description: Recombinant Human Early Growth Response Protein 2 expressed in: E.coli |
Recombinant Early Growth Response Protein 2 (EGR2) |
4-RPB451Mu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P08152
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 29.5kDa
- Isoelectric Point: 9.2
|
Description: Recombinant Mouse Early Growth Response Protein 2 expressed in: E.coli |
EGR2 Protein Vector (Human) (pPB-C-His) |
PV013749 |
ABM |
500 ng |
EUR 329 |
EGR2 Protein Vector (Human) (pPB-N-His) |
PV013750 |
ABM |
500 ng |
EUR 329 |
EGR2 Protein Vector (Human) (pPM-C-HA) |
PV013751 |
ABM |
500 ng |
EUR 329 |
EGR2 Rabbit Polyclonal Antibody