EPS8 Rabbit Polyclonal Antibody

EPS8 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

EPS8 Polyclonal Antibody
ES9052-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against EPS8 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
EPS8 Polyclonal Antibody
ABP58492-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of EPS8 from Human, Mouse. This EPS8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210
EPS8 Polyclonal Antibody
ABP58492-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of EPS8 from Human, Mouse. This EPS8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210
EPS8 Polyclonal Antibody
ABP58492-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of EPS8 from Human, Mouse. This EPS8 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human EPS8 protein at amino acid sequence of 130-210
EPS8 Polyclonal Antibody
28687-100ul 100ul
EUR 252
EPS8 Polyclonal Antibody
28687-50ul 50ul
EUR 187
EPS8 Rabbit pAb
A14730-100ul 100 ul
EUR 308
EPS8 Rabbit pAb
A14730-200ul 200 ul
EUR 459
EPS8 Rabbit pAb
A14730-20ul 20 ul
EUR 183
EPS8 Rabbit pAb
A14730-50ul 50 ul
EUR 223
EPS8 Rabbit pAb
A8826-100ul 100 ul
EUR 308
EPS8 Rabbit pAb
A8826-200ul 200 ul
EUR 459
EPS8 Rabbit pAb
A8826-20ul 20 ul Ask for price
EPS8 Rabbit pAb
A8826-50ul 50 ul Ask for price
EPS8 Polyclonal Conjugated Antibody
C28687 100ul
EUR 397
EPS8 antibody
70R-3683 50 ug
EUR 467
Description: Rabbit polyclonal EPS8 antibody raised against the middle region of EPS8
EPS8 Antibody
ABD8413 100 ug
EUR 438
EPS8 antibody
22105-100ul 100ul
EUR 390
EPS8 antibody
70R-17121 50 ul
EUR 435
Description: Rabbit polyclonal EPS8 antibody
EPS8 antibody
70R-12509 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal EPS8 antibody
EPS8 Antibody
DF8413 200ul
EUR 304
Description: EPS8 Antibody detects endogenous levels of total EPS8.
EPS8 Antibody
1-CSB-PA007751GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
EPS8 Antibody
1-CSB-PA615539LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500
Polyclonal EPS8 Antibody (C-Term)
APG00422G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EPS8 (C-Term). This antibody is tested and proven to work in the following applications:
anti- EPS8 antibody
FNab02819 100µg
EUR 585
  • Immunogen: epidermal growth factor receptor pathway substrate 8
  • Uniprot ID: Q12929
  • Gene ID: 2059
  • Research Area: Signal Transduction
Description: Antibody raised against EPS8
Anti-EPS8 antibody
PAab02819 100 ug
EUR 412
Anti-EPS8 antibody
STJ70422 100 µg
EUR 359
Anti-EPS8 antibody
STJ113588 100 µl
EUR 277
Description: This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized.
Anti-EPS8 antibody
STJ116930 100 µl
EUR 277
Description: This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized.
Anti-EPS8 antibody
STJ190210 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to EPS8
EPS8 siRNA
20-abx901758
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EPS8 siRNA
20-abx915564
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
EPS8 siRNA
20-abx915565
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-EPS8
YF-PA11611 50 ug
EUR 363
Description: Mouse polyclonal to EPS8
EPS8 Antibody, HRP conjugated
1-CSB-PA615539LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
EPS8 Antibody, FITC conjugated
1-CSB-PA615539LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
EPS8 Antibody, Biotin conjugated
1-CSB-PA615539LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EPS8. Recognizes EPS8 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
EPS8 cloning plasmid
CSB-CL615539HU-10ug 10ug
EUR 801
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2469
  • Sequence: atgaatggtcatatttctaatcatcccagtagttttggaatgtacccatctcagatgaatggctacggatcatcacctaccttttcccagacggacagagaacatggttcaaaaacaagtgcaaaggccctttatgaacaaaggaagaattatgcacgggacagtgtcagcagtg
  • Show more
Description: A cloning plasmid for the EPS8 gene.
EPS8 Blocking Peptide
33R-9810 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EPS8 antibody, catalog no. 70R-3683
EPS8 Blocking Peptide
DF8413-BP 1mg
EUR 195
EPS8 Like 2 (EPS8L2) Antibody
20-abx112321
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody
abx033058-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody
abx033058-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody
20-abx008042
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
EPS8 Like 2 (EPS8L2) Antibody
20-abx008058
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
EPS8 Like 2 (EPS8L2) Antibody
abx031067-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
EPS8 Like 2 (EPS8L2) Antibody
abx031067-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody
20-abx013717
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
EPS8 Like 1 (EPS8L1) Antibody
abx028818-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
EPS8 Like 1 (EPS8L1) Antibody
abx028818-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody
20-abx323121
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 1 (EPS8L1) Antibody
20-abx326140
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 2 (EPS8L2) Antibody
20-abx326203
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 2 (EPS8L2) Antibody
20-abx312033
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 3 (Eps8L3) Antibody
20-abx215212
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody
abx330550-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
EPS8 Like 1 (EPS8L1) Antibody
abx331587-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
EPS8 Like 2 (EPS8L2) Antibody
abx331771-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody
20-abx334380
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 2 (EPS8L2) Antibody
abx232820-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Rat EPS8 shRNA Plasmid
20-abx989736
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human EPS8 ELISA KIT
ELI-08314h 96 Tests
EUR 824
Mouse Eps8 ELISA KIT
ELI-26890m 96 Tests
EUR 865
EPS8 ELISA KIT|Human
EF007491 96 Tests
EUR 689
Human EPS8 shRNA Plasmid
20-abx951436
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse EPS8 shRNA Plasmid
20-abx970207
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
EPS8 Recombinant Protein (Human)
RP010819 100 ug Ask for price
EPS8 Recombinant Protein (Mouse)
RP132056 100 ug Ask for price
EPS8 Like 2 (EPS8L2) Antibody (HRP)
20-abx312034
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 2 (EPS8L2) Antibody (FITC)
20-abx312035
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 2 (EPS8L2) Antibody (Biotin)
20-abx312036
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody (HRP)
20-abx335595
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody (FITC)
20-abx335596
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 Like 3 (EPS8L3) Antibody (Biotin)
20-abx335597
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
EPS8 ORF Vector (Human) (pORF)
ORF003607 1.0 ug DNA
EUR 95
Eps8 ORF Vector (Mouse) (pORF)
ORF044020 1.0 ug DNA
EUR 506
EPS8 ELISA Kit (Human) (OKWB00223)
OKWB00223 96 Wells
EUR 572
Description: Description of target: Signaling adapter that controls various cellular protrusions by regulating actin cytoskeleton dynamics and architecture. Depending on its association with other signal transducers, can regulate different processes. Together with SOS1 and ABI1, forms a trimeric complex that participates in transduction of signals from Ras to Rac by activating the Rac-specific guanine nucleotide exchange factor (GEF) activity. Acts as a direct regulator of actin dynamics by binding actin filaments and has both barbed-end actin filament capping and actin bundling activities depending on the context. Displays barbed-end actin capping activity when associated with ABI1, thereby regulating actin-based motility process: capping activity is auto-inhibited and inhibition is relieved upon ABI1 interaction. Also shows actin bundling activity when associated with BAIAP2, enhancing BAIAP2-dependent membrane extensions and promoting filopodial protrusions. Involved in the regulation of processes such as axonal filopodia growth, stereocilia length, dendritic cell migration and cancer cell migration and invasion. Acts as a regulator of axonal filopodia formation in neurons: in the absence of neurotrophic factors, negatively regulates axonal filopodia formation via actin-capping activity. In contrast, it is phosphorylated in the presence of BDNF leading to inhibition of its actin-capping activity and stimulation of filopodia formation. Component of a complex with WHRN and MYO15A that localizes at stereocilia tips and is required for elongation of the stereocilia actin core. Indirectly involved in cell cycle progression; its degradation following ubiquitination being required during G2 phase to promote cell shape changes.;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL
Eps8 sgRNA CRISPR Lentivector set (Mouse)
K4413401 3 x 1.0 ug
EUR 339
EPS8 sgRNA CRISPR Lentivector set (Human)
K0689001 3 x 1.0 ug
EUR 339
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody
20-abx124083
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody
20-abx112317
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody
abx033909-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody
abx033909-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody
20-abx334342
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody
abx431233-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody
abx232819-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Eps8 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4413402 1.0 ug DNA
EUR 154
Eps8 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4413403 1.0 ug DNA
EUR 154
Eps8 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4413404 1.0 ug DNA
EUR 154
EPS8 sgRNA CRISPR Lentivector (Human) (Target 1)
K0689002 1.0 ug DNA
EUR 154
EPS8 sgRNA CRISPR Lentivector (Human) (Target 2)
K0689003 1.0 ug DNA
EUR 154
EPS8 sgRNA CRISPR Lentivector (Human) (Target 3)
K0689004 1.0 ug DNA
EUR 154
EPS8 Protein Vector (Mouse) (pPB-C-His)
PV176078 500 ng
EUR 1065
EPS8 Protein Vector (Mouse) (pPB-N-His)
PV176079 500 ng
EUR 1065
EPS8 Protein Vector (Mouse) (pPM-C-HA)
PV176080 500 ng
EUR 1065
EPS8 Protein Vector (Mouse) (pPM-C-His)
PV176081 500 ng
EUR 1065
EPS8 Protein Vector (Human) (pPB-C-His)
PV014425 500 ng
EUR 329
EPS8 Protein Vector (Human) (pPB-N-His)
PV014426 500 ng
EUR 329
EPS8 Protein Vector (Human) (pPM-C-HA)
PV014427 500 ng
EUR 329
EPS8 Protein Vector (Human) (pPM-C-His)
PV014428 500 ng
EUR 329
Eps8 3'UTR Luciferase Stable Cell Line
TU204052 1.0 ml Ask for price
Eps8 3'UTR GFP Stable Cell Line
TU155895 1.0 ml Ask for price
EPS8 3'UTR Luciferase Stable Cell Line
TU006979 1.0 ml
EUR 1394
Eps8 3'UTR Luciferase Stable Cell Line
TU105895 1.0 ml Ask for price
EPS8 3'UTR GFP Stable Cell Line
TU056979 1.0 ml
EUR 1394
Eps8 3'UTR GFP Stable Cell Line
TU254052 1.0 ml Ask for price
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody (HRP)
20-abx335592
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody (FITC)
20-abx335593
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Epidermal Growth Factor Receptor Pathway Substrate 8 (EPS8) Antibody (Biotin)
20-abx335594
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human EPS8 Like Protein 2 (EPS8L2) ELISA Kit
20-abx387168
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Mouse EPS8 Like Protein 2 (EPS8L2) ELISA Kit
20-abx389183
  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
VEGF Rabbit Polyclonal Antibody
ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
VEGF Rabbit Polyclonal Antibody
ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
CD10 Rabbit Polyclonal Antibody
ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
NM23A Rabbit Polyclonal Antibody
ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATM Rabbit Polyclonal Antibody
ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSC70 Rabbit Polyclonal Antibody
ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP40 Rabbit Polyclonal Antibody
ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
HSP90? Rabbit Polyclonal Antibody
ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
IkB ? Rabbit Polyclonal Antibody
ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK1 Rabbit Polyclonal Antibody
ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JAK2 Rabbit Polyclonal Antibody
ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK2 Rabbit Polyclonal Antibody
ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
JNK3 Rabbit Polyclonal Antibody
ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK2 Rabbit Polyclonal Antibody
ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
MEK3 Rabbit Polyclonal Antibody
ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4a Rabbit Polyclonal Antibody
ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4b Rabbit Polyclonal Antibody
ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
ATG4c Rabbit Polyclonal Antibody
ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

EPS8 Rabbit Polyclonal Antibody

Back To Top