FA2H Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
FA2H Polyclonal Antibody |
ABP58517-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human FA2H protein at amino acid sequence of 101-150
- Applications tips:
|
Description: A polyclonal antibody for detection of FA2H from Human, Mouse, Rat. This FA2H antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FA2H protein at amino acid sequence of 101-150 |
FA2H Polyclonal Antibody |
46899-100ul |
SAB |
100ul |
EUR 252 |
FA2H Polyclonal Antibody |
46899-50ul |
SAB |
50ul |
EUR 187 |
FA2H Rabbit pAb |
A13873-100ul |
Abclonal |
100 ul |
EUR 308 |
FA2H Rabbit pAb |
A13873-200ul |
Abclonal |
200 ul |
EUR 459 |
FA2H Rabbit pAb |
A13873-20ul |
Abclonal |
20 ul |
EUR 183 |
FA2H Rabbit pAb |
A13873-50ul |
Abclonal |
50 ul |
EUR 223 |
FA2H Rabbit pAb |
A13874-100ul |
Abclonal |
100 ul |
EUR 308 |
FA2H Rabbit pAb |
A13874-200ul |
Abclonal |
200 ul |
EUR 459 |
FA2H Rabbit pAb |
A13874-20ul |
Abclonal |
20 ul |
EUR 183 |
FA2H Rabbit pAb |
A13874-50ul |
Abclonal |
50 ul |
EUR 223 |
FA2H Polyclonal Conjugated Antibody |
C46899 |
SAB |
100ul |
EUR 397 |
Fa2h antibody |
70R-7969 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal Fa2h antibody |
FA2H antibody |
70R-17188 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal FA2H antibody |
FA2H Antibody |
DF12995 |
Affbiotech |
200ul |
EUR 304 |
Description: FA2H Antibody detects endogenous levels of FA2H. |
FA2H Antibody |
1-CSB-PA007937GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against FA2H. Recognizes FA2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
FA2H Antibody |
1-CSB-PA316430 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against FA2H. Recognizes FA2H from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
Polyclonal Fa2h antibody - C-terminal region |
APR11890G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Fa2h - C-terminal region. This antibody is tested and proven to work in the following applications: |
anti- FA2H antibody |
FNab02926 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: fatty acid 2-hydroxylase
- Uniprot ID: Q7L5A8
- Gene ID: 79152
- Research Area: Neuroscience, Metabolism
|
Description: Antibody raised against FA2H |
Anti-FA2H antibody |
STJ99320 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to FA2H. |
Anti-FA2H antibody |
STJ115812 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia. |
Anti-FA2H antibody |
STJ115813 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a protein that catalyzes the synthesis of 2-hydroxysphingolipids, a subset of sphingolipids that contain 2-hydroxy fatty acids. Sphingolipids play roles in many cellular processes and their structural diversity arises from modification of the hydrophobic ceramide moiety, such as by 2-hydroxylation of the N-acyl chain, and the existence of many different head groups. Mutations in this gene have been associated with leukodystrophy dysmyelinating with spastic paraparesis with or without dystonia. |
FA2H siRNA |
20-abx901812 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FA2H siRNA |
20-abx915896 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
FA2H siRNA |
20-abx915897 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-FA2H |
YF-PA20765 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to FA2H |
FA2H cloning plasmid |
CSB-CL007937HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 843
- Sequence: atggagaacgagcctgtagcccttgaggaaactcagaagacagatcctgctatggaaccacggttcaaagtggtggattgggacaaggacctggtggactggcgaaagcctctcctgtggcaggtgggccacttgggagagaagtacgatgagtgggttcaccagccggtgaccag
- Show more
|
Description: A cloning plasmid for the FA2H gene. |
FA2H cloning plasmid |
CSB-CL007937HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 843
- Sequence: atggagaacgagcctgtagcccttgaggaaactcagaagacagatcctgctatggaaccacggttcaaagtggtggattgggacaaggacctggtggactggcgaaagcctctcctgtggcaggtgggccacttgggagagaagtacgatgagtgggttcaccagccggtgaccag
- Show more
|
Description: A cloning plasmid for the FA2H gene. |
FA2H cloning plasmid |
CSB-CL007937HU3-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 357
- Sequence: atgcccaagcctctccatctgcaggcacccttcgacggctcccgcctggtcttcccccctgtgccagcctccctggtgatcggcgtcttctacttgtgcatgcagctcatcctgcctgaggcagtagggggcactgtgtttgcggggggcctcctgggctacgtcctctatgacat
- Show more
|
Description: A cloning plasmid for the FA2H gene. |
Fa2h Blocking Peptide |
33R-3743 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Fa2h antibody, catalog no. 70R-7969 |
FA2H Blocking Peptide |
DF12995-BP |
Affbiotech |
1mg |
EUR 195 |
Rat FA2H shRNA Plasmid |
20-abx989455 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse FA2H shRNA Plasmid |
20-abx983700 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human FA2H shRNA Plasmid |
20-abx962330 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
FA2H Recombinant Protein (Human) |
RP011140 |
ABM |
100 ug |
Ask for price |
FA2H Recombinant Protein (Human) |
RP011143 |
ABM |
100 ug |
Ask for price |
FA2H Recombinant Protein (Human) |
RP011146 |
ABM |
100 ug |
Ask for price |
FA2H Recombinant Protein (Rat) |
RP200216 |
ABM |
100 ug |
Ask for price |
FA2H Recombinant Protein (Mouse) |
RP132674 |
ABM |
100 ug |
Ask for price |
Fatty Acid 2-Hydroxylase (FA2H) Antibody |
20-abx112477 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fatty Acid 2-Hydroxylase (FA2H) Antibody |
20-abx329806 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Fatty Acid 2-Hydroxylase (FA2H) Antibody |
abx232926-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
FA2H ORF Vector (Human) (pORF) |
ORF003714 |
ABM |
1.0 ug DNA |
EUR 95 |
FA2H ORF Vector (Human) (pORF) |
ORF003715 |
ABM |
1.0 ug DNA |
EUR 95 |
FA2H ORF Vector (Human) (pORF) |
ORF003716 |
ABM |
1.0 ug DNA |
EUR 95 |
Fa2h ORF Vector (Rat) (pORF) |
ORF066740 |
ABM |
1.0 ug DNA |
EUR 506 |
Fa2h ORF Vector (Mouse) (pORF) |
ORF044226 |
ABM |
1.0 ug DNA |
EUR 506 |
Fa2h sgRNA CRISPR Lentivector set (Rat) |
K6296401 |
ABM |
3 x 1.0 ug |
EUR 339 |
FA2H sgRNA CRISPR Lentivector set (Human) |
K0708301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fa2h sgRNA CRISPR Lentivector set (Mouse) |
K5027201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Fa2h sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6296402 |
ABM |
1.0 ug DNA |
EUR 154 |
Fa2h sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6296403 |
ABM |
1.0 ug DNA |
EUR 154 |
Fa2h sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6296404 |
ABM |
1.0 ug DNA |
EUR 154 |
FA2H sgRNA CRISPR Lentivector (Human) (Target 1) |
K0708302 |
ABM |
1.0 ug DNA |
EUR 154 |
FA2H sgRNA CRISPR Lentivector (Human) (Target 2) |
K0708303 |
ABM |
1.0 ug DNA |
EUR 154 |
FA2H sgRNA CRISPR Lentivector (Human) (Target 3) |
K0708304 |
ABM |
1.0 ug DNA |
EUR 154 |
Fa2h sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K5027202 |
ABM |
1.0 ug DNA |
EUR 154 |
Fa2h sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K5027203 |
ABM |
1.0 ug DNA |
EUR 154 |
Fa2h sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K5027204 |
ABM |
1.0 ug DNA |
EUR 154 |
FA2H Protein Vector (Mouse) (pPB-C-His) |
PV176902 |
ABM |
500 ng |
EUR 603 |
FA2H Protein Vector (Mouse) (pPB-N-His) |
PV176903 |
ABM |
500 ng |
EUR 603 |
FA2H Protein Vector (Mouse) (pPM-C-HA) |
PV176904 |
ABM |
500 ng |
EUR 603 |
FA2H Protein Vector (Mouse) (pPM-C-His) |
PV176905 |
ABM |
500 ng |
EUR 603 |
FA2H Protein Vector (Human) (pPB-C-His) |
PV014853 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPB-N-His) |
PV014854 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPM-C-HA) |
PV014855 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPM-C-His) |
PV014856 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPB-C-His) |
PV014857 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPB-N-His) |
PV014858 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPM-C-HA) |
PV014859 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPM-C-His) |
PV014860 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPB-C-His) |
PV014861 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPB-N-His) |
PV014862 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPM-C-HA) |
PV014863 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Human) (pPM-C-His) |
PV014864 |
ABM |
500 ng |
EUR 329 |
FA2H Protein Vector (Rat) (pPB-C-His) |
PV266958 |
ABM |
500 ng |
EUR 603 |
FA2H Protein Vector (Rat) (pPB-N-His) |
PV266959 |
ABM |
500 ng |
EUR 603 |
FA2H Protein Vector (Rat) (pPM-C-HA) |
PV266960 |
ABM |
500 ng |
EUR 603 |
FA2H Protein Vector (Rat) (pPM-C-His) |
PV266961 |
ABM |
500 ng |
EUR 603 |
Fa2h 3'UTR Luciferase Stable Cell Line |
TU204197 |
ABM |
1.0 ml |
Ask for price |
Fa2h 3'UTR GFP Stable Cell Line |
TU156067 |
ABM |
1.0 ml |
Ask for price |
FA2H 3'UTR Luciferase Stable Cell Line |
TU007178 |
ABM |
1.0 ml |
EUR 1394 |
Fa2h 3'UTR Luciferase Stable Cell Line |
TU106067 |
ABM |
1.0 ml |
Ask for price |
FA2H 3'UTR GFP Stable Cell Line |
TU057178 |
ABM |
1.0 ml |
EUR 1394 |
Fa2h 3'UTR GFP Stable Cell Line |
TU254197 |
ABM |
1.0 ml |
Ask for price |
Human Fatty acid 2- hydroxylase, FA2H ELISA KIT |
ELI-20611h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Fatty acid 2- hydroxylase, Fa2h ELISA KIT |
ELI-38515m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Fatty Acid 2-Hydroxylase (FA2H) ELISA Kit |
abx387237-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Fatty Acid 2-Hydroxylase (FA2H) ELISA Kit |
abx389254-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Rat Fatty Acid 2-Hydroxylase (FA2H) ELISA Kit |
abx391316-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
FA2H Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV696949 |
ABM |
1.0 ug DNA |
EUR 682 |
FA2H Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV696953 |
ABM |
1.0 ug DNA |
EUR 682 |
FA2H Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV696954 |
ABM |
1.0 ug DNA |
EUR 682 |
FA2H Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV709887 |
ABM |
1.0 ug DNA |
EUR 316 |
FA2H Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV709891 |
ABM |
1.0 ug DNA |
EUR 316 |
FA2H Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV709892 |
ABM |
1.0 ug DNA |
EUR 316 |
FA2H Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
LV709893 |
ABM |
1.0 ug DNA |
EUR 316 |
FA2H Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV709897 |
ABM |
1.0 ug DNA |
EUR 316 |
FA2H Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV709898 |
ABM |
1.0 ug DNA |
EUR 316 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
FA2H Rabbit Polyclonal Antibody