FHL3 Rabbit Polyclonal Antibody

FHL3 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

FHL3 Polyclonal Antibody
ABP58554-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FHL3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of FHL3 from Human, Mouse. This FHL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FHL3 protein at amino acid sequence of 40-120
FHL3 Polyclonal Antibody
ABP58554-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FHL3 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of FHL3 from Human, Mouse. This FHL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FHL3 protein at amino acid sequence of 40-120
FHL3 Polyclonal Antibody
ES9059-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FHL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
FHL3 Polyclonal Antibody
ES9059-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FHL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
FHL3 Rabbit pAb
A8679-100ul 100 ul
EUR 308
FHL3 Rabbit pAb
A8679-200ul 200 ul
EUR 459
FHL3 Rabbit pAb
A8679-20ul 20 ul
EUR 183
FHL3 Rabbit pAb
A8679-50ul 50 ul
EUR 223
FHL3 antibody
70R-17303 50 ul
EUR 435
Description: Rabbit polyclonal FHL3 antibody
FHL3 Antibody
36483-100ul 100ul
EUR 252
FHL3 Antibody
1-CSB-PA618796ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
FHL3 Antibody
1-CSB-PA618796ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
FHL3 Antibody
1-CSB-PA977533
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200
FHL3 Antibody
1-CSB-PA985521
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
FHL3 Antibody
DF8826 200ul
EUR 304
Description: FHL3 Antibody detects endogenous levels of total FHL3.
FHL3 antibody
70R-49746 100 ul
EUR 244
Description: Purified Polyclonal FHL3 antibody
FHL3 antibody
70R-8913 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal FHL3 antibody
FHL3 Antibody
1-CSB-PA008665GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FHL3. Recognizes FHL3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
FHL3 Antibody
ABD8826 100 ug
EUR 438
Polyclonal Goat Anti-FHL3 / SLIM2 Antibody
APG00126G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-FHL3 / SLIM2 . This antibody is tested and proven to work in the following applications:
FHL3 Conjugated Antibody
C36483 100ul
EUR 397
anti- FHL3 antibody
FNab03112 100µg
EUR 505.25
  • Immunogen: four and a half LIM domains 3
  • Uniprot ID: Q13643
  • Gene ID: 2275
  • Research Area: Developmental biology
Description: Antibody raised against FHL3
Anti-FHL3 antibody
PAab03112 100 ug
EUR 355
Anti-FHL3 Antibody
PB10064 100ug/vial
EUR 294
Anti-FHL3 antibody
STJ111377 100 µl
EUR 277
Description: The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene.
Anti-FHL3 antibody
STJ190217 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FHL3
FHL3 siRNA
20-abx916878
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
FHL3 siRNA
20-abx916879
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Anti-FHL3 / SLIM2 antibody
STJ70600 100 µg
EUR 359
FHL3 Blocking Peptide
33R-3837 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FHL3 antibody, catalog no. 70R-8913
FHL3 Blocking Peptide
DF8826-BP 1mg
EUR 195
FHL3 Blocking Peptide
20-abx062621
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
FHL3 cloning plasmid
CSB-CL618796HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 519
  • Sequence: atgcctgggtcccggaagctggaatatggaggccagacatggcatgagcactgcttcctgtgcagtggctgtgaacagccactgggctcccgttcttttgtgcccgacaagggtgctcactactgcgtgccctgctatgagaacaagtttgctcctcgctgcgcccgctgcagcaa
  • Show more
Description: A cloning plasmid for the FHL3 gene.
FHL3 cloning plasmid
CSB-CL618796HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 843
  • Sequence: atgagcgagtcatttgactgtgcaaaatgcaacgagtccctgtatggacgcaagtacatccagacagacagcggcccctactgtgtgccctgctatgacaatacctttgccaacacctgtgctgagtgccagcagcttatcgggcatgactcgagggagctgttctatgaagaccg
  • Show more
Description: A cloning plasmid for the FHL3 gene.
pENTR223-FHL3 vector
PVT11935 2 ug
EUR 308
Anti-FHL3 (2C10)
YF-MA13026 100 ug
EUR 363
Description: Mouse monoclonal to FHL3
FHL3 protein (His tag)
80R-3544 50 ug
EUR 327
Description: Purified recombinant FHL3 protein (His tag)
FHL3 ELISA KIT|Human
EF009628 96 Tests
EUR 689
Mouse FHL3 shRNA Plasmid
20-abx970340
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human FHL3 shRNA Plasmid
20-abx951592
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
FHL3 Recombinant Protein (Human)
RP012172 100 ug Ask for price
FHL3 Recombinant Protein (Human)
RP012175 100 ug Ask for price
FHL3 Recombinant Protein (Rat)
RP201401 100 ug Ask for price
FHL3 Recombinant Protein (Mouse)
RP134603 100 ug Ask for price
Fhl3 ORF Vector (Rat) (pORF)
ORF067135 1.0 ug DNA
EUR 506
FHL3 ORF Vector (Human) (pORF)
ORF004058 1.0 ug DNA
EUR 95
FHL3 ORF Vector (Human) (pORF)
ORF004059 1.0 ug DNA
EUR 95
Fhl3 ORF Vector (Mouse) (pORF)
ORF044869 1.0 ug DNA
EUR 506
Fhl3 sgRNA CRISPR Lentivector set (Rat)
K6174801 3 x 1.0 ug
EUR 339
FHL3 sgRNA CRISPR Lentivector set (Human)
K0782001 3 x 1.0 ug
EUR 339
Fhl3 sgRNA CRISPR Lentivector set (Mouse)
K4460501 3 x 1.0 ug
EUR 339
Four And A Half LIM Domains 3 (FHL3) Antibody
20-abx009262
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Four And A Half LIM Domains 3 (FHL3) Antibody
abx215361-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
Four And A Half LIM Domains 3 (FHL3) Antibody
20-abx210835
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Four And A Half LIM Domains 3 (FHL3) Antibody
20-abx212508
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Four And A Half LIM Domains 3 (FHL3) Antibody
20-abx112586
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Four And A Half LIM Domains 3 (FHL3) Antibody
20-abx123606
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Four And A Half LIM Domains 3 (FHL3) Antibody
20-abx321199
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Four And A Half LIM Domains 3 (FHL3) Antibody
abx233112-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Four And A Half LIM Domains 3 (FHL3) Antibody
20-abx322016
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Four And A Half LIM Domains 3 (FHL3) Antibody
abx430147-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6174802 1.0 ug DNA
EUR 154
Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6174803 1.0 ug DNA
EUR 154
Fhl3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6174804 1.0 ug DNA
EUR 154
FHL3 sgRNA CRISPR Lentivector (Human) (Target 1)
K0782002 1.0 ug DNA
EUR 154
FHL3 sgRNA CRISPR Lentivector (Human) (Target 2)
K0782003 1.0 ug DNA
EUR 154
FHL3 sgRNA CRISPR Lentivector (Human) (Target 3)
K0782004 1.0 ug DNA
EUR 154
Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4460502 1.0 ug DNA
EUR 154
Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4460503 1.0 ug DNA
EUR 154
Fhl3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4460504 1.0 ug DNA
EUR 154
FHL3 Protein Vector (Mouse) (pPB-C-His)
PV179474 500 ng
EUR 603
FHL3 Protein Vector (Mouse) (pPB-N-His)
PV179475 500 ng
EUR 603
FHL3 Protein Vector (Mouse) (pPM-C-HA)
PV179476 500 ng
EUR 603
FHL3 Protein Vector (Mouse) (pPM-C-His)
PV179477 500 ng
EUR 603
FHL3 Protein Vector (Rat) (pPB-C-His)
PV268538 500 ng
EUR 603
FHL3 Protein Vector (Rat) (pPB-N-His)
PV268539 500 ng
EUR 603
FHL3 Protein Vector (Rat) (pPM-C-HA)
PV268540 500 ng
EUR 603
FHL3 Protein Vector (Rat) (pPM-C-His)
PV268541 500 ng
EUR 603
FHL3 Protein Vector (Human) (pPB-C-His)
PV016229 500 ng
EUR 329
FHL3 Protein Vector (Human) (pPB-N-His)
PV016230 500 ng
EUR 329
FHL3 Protein Vector (Human) (pPM-C-HA)
PV016231 500 ng
EUR 329
FHL3 Protein Vector (Human) (pPM-C-His)
PV016232 500 ng
EUR 329
FHL3 Protein Vector (Human) (pPB-C-His)
PV016233 500 ng
EUR 329
FHL3 Protein Vector (Human) (pPB-N-His)
PV016234 500 ng
EUR 329
FHL3 Protein Vector (Human) (pPM-C-HA)
PV016235 500 ng
EUR 329
FHL3 Protein Vector (Human) (pPM-C-His)
PV016236 500 ng
EUR 329
Fhl3 3'UTR GFP Stable Cell Line
TU156570 1.0 ml Ask for price
Fhl3 3'UTR Luciferase Stable Cell Line
TU106570 1.0 ml Ask for price
Fhl3 3'UTR Luciferase Stable Cell Line
TU204634 1.0 ml Ask for price
Fhl3 3'UTR GFP Stable Cell Line
TU254634 1.0 ml Ask for price
FHL3 3'UTR GFP Stable Cell Line
TU057969 1.0 ml
EUR 1394
FHL3 3'UTR Luciferase Stable Cell Line
TU007969 1.0 ml
EUR 1394
FHL3 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV710163 1.0 ug DNA
EUR 316
FHL3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV710167 1.0 ug DNA
EUR 316
FHL3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV710168 1.0 ug DNA
EUR 316
GAPDH Rabbit Polyclonal Antibody
37985-100ul 100ul
EUR 252
GAPDH Rabbit Polyclonal Antibody
37985-50ul 50ul
EUR 187
EFHD1 Rabbit Polyclonal Antibody
38001-100ul 100ul
EUR 252
EFHD1 Rabbit Polyclonal Antibody
38001-50ul 50ul
EUR 187

FHL3 Rabbit Polyclonal Antibody

Back To Top