GCM2 Rabbit Polyclonal Antibody

GCM2 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

GCM2 Polyclonal Antibody

ABP58621-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human GCM2 protein at amino acid sequence of 21-70
  • Applications tips:
Description: A polyclonal antibody for detection of GCM2 from Human, Mouse, Rat. This GCM2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GCM2 protein at amino acid sequence of 21-70

GCM2 Polyclonal Antibody

46909-100ul 100ul
EUR 252

GCM2 Polyclonal Antibody

46909-50ul 50ul
EUR 187

GCM2 antibody

70R-17446 50 ul
EUR 435
Description: Rabbit polyclonal GCM2 antibody

GCM2 antibody

70R-13412 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal GCM2 antibody

GCM2 Antibody

1-CSB-PA725603
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

GCM2 Antibody

1-CSB-PA009324GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GCM2 Antibody

1-CSB-PA009324LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

Polyclonal GCM2 Antibody - N-terminal region

APR01856G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GCM2 - N-terminal region. This antibody is tested and proven to work in the following applications:

anti- GCM2 antibody

FNab03388 100µg
EUR 548.75
  • Immunogen: glial cells missing homolog 2(Drosophila)
  • Uniprot ID: O75603
  • Gene ID: 9247
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against GCM2

Anti-GCM2 antibody

PAab03388 100 ug
EUR 386

Anti-GCM2 antibody

STJ99332 200 µl
EUR 197
Description: Rabbit polyclonal to GCM2.

GCM2 siRNA

20-abx917694
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GCM2 siRNA

20-abx917695
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GCM2 Antibody, HRP conjugated

1-CSB-PA009324LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GCM2 Antibody, FITC conjugated

1-CSB-PA009324LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GCM2 Antibody, Biotin conjugated

1-CSB-PA009324LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GCM2. Recognizes GCM2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GCM2 cloning plasmid

CSB-CL009324HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1521
  • Sequence: atgccggcggccgcggtgcaggaagcggtcggcgtgtgctcctacgggatgcagctcagctgggacatcaacgatccgcagatgcctcaggagctggccctctttgaccaattccgagagtggcctgacggctatgtgcgcttcatctacagcagcgatgagaagaaggcacagc
  • Show more
Description: A cloning plasmid for the GCM2 gene.

Mouse GCM2 shRNA Plasmid

20-abx979848
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Gcm2 ELISA KIT

ELI-08189m 96 Tests
EUR 865

GCM2 ELISA KIT|Human

EF009806 96 Tests
EUR 689

Human GCM2 ELISA KIT

ELI-31260h 96 Tests
EUR 824

Human GCM2 shRNA Plasmid

20-abx956122
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GCM2 Recombinant Protein (Human)

RP039427 100 ug Ask for price

GCM2 Recombinant Protein (Rat)

RP202385 100 ug Ask for price

GCM2 Recombinant Protein (Mouse)

RP136151 100 ug Ask for price

Rabbit Chorion specific transcription factor GCMb(GCM2) ELISA kit

E04C2295-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chorion specific transcription factor GCMb(GCM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chorion specific transcription factor GCMb(GCM2) ELISA kit

E04C2295-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chorion specific transcription factor GCMb(GCM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chorion specific transcription factor GCMb(GCM2) ELISA kit

E04C2295-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chorion specific transcription factor GCMb(GCM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chorion-Specific Transcription Factor GCMb (GCM2) Antibody

20-abx112725
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chorion-Specific Transcription Factor GCMb (GCM2) Antibody

abx122499-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chorion-Specific Transcription Factor GCMb (GCM2) Antibody

20-abx329808
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chorion-Specific Transcription Factor GCMb (GCM2) Antibody

20-abx318752
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chorion-Specific Transcription Factor GCMb (GCM2) Antibody

abx233388-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Gcm2 ORF Vector (Rat) (pORF)

ORF067463 1.0 ug DNA
EUR 506

Gcm2 ORF Vector (Mouse) (pORF)

ORF045385 1.0 ug DNA
EUR 506

GCM2 ORF Vector (Human) (pORF)

ORF013143 1.0 ug DNA
EUR 354

Chorion-Specific Transcription Factor GCMb (GCM2) Antibody (HRP)

20-abx315747
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chorion-Specific Transcription Factor GCMb (GCM2) Antibody (FITC)

20-abx315748
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chorion-Specific Transcription Factor GCMb (GCM2) Antibody (Biotin)

20-abx315749
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gcm2 sgRNA CRISPR Lentivector set (Mouse)

K4052201 3 x 1.0 ug
EUR 339

GCM2 sgRNA CRISPR Lentivector set (Human)

K0847401 3 x 1.0 ug
EUR 339

Gcm2 sgRNA CRISPR Lentivector set (Rat)

K6729401 3 x 1.0 ug
EUR 339

Gcm2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4052202 1.0 ug DNA
EUR 154

Gcm2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4052203 1.0 ug DNA
EUR 154

Gcm2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4052204 1.0 ug DNA
EUR 154

GCM2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0847402 1.0 ug DNA
EUR 154

GCM2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0847403 1.0 ug DNA
EUR 154

GCM2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0847404 1.0 ug DNA
EUR 154

Gcm2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6729402 1.0 ug DNA
EUR 154

Gcm2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6729403 1.0 ug DNA
EUR 154

Gcm2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6729404 1.0 ug DNA
EUR 154

GCM2 Protein Vector (Human) (pPB-C-His)

PV052569 500 ng
EUR 481

GCM2 Protein Vector (Human) (pPB-N-His)

PV052570 500 ng
EUR 481

GCM2 Protein Vector (Human) (pPM-C-HA)

PV052571 500 ng
EUR 481

GCM2 Protein Vector (Human) (pPM-C-His)

PV052572 500 ng
EUR 481

GCM2 Protein Vector (Rat) (pPB-C-His)

PV269850 500 ng
EUR 603

GCM2 Protein Vector (Rat) (pPB-N-His)

PV269851 500 ng
EUR 603

GCM2 Protein Vector (Rat) (pPM-C-HA)

PV269852 500 ng
EUR 603

GCM2 Protein Vector (Rat) (pPM-C-His)

PV269853 500 ng
EUR 603

GCM2 Protein Vector (Mouse) (pPB-C-His)

PV181538 500 ng
EUR 603

GCM2 Protein Vector (Mouse) (pPB-N-His)

PV181539 500 ng
EUR 603

GCM2 Protein Vector (Mouse) (pPM-C-HA)

PV181540 500 ng
EUR 603

GCM2 Protein Vector (Mouse) (pPM-C-His)

PV181541 500 ng
EUR 603

Gcm2 3'UTR Luciferase Stable Cell Line

TU205007 1.0 ml Ask for price

Gcm2 3'UTR GFP Stable Cell Line

TU156974 1.0 ml Ask for price

GCM2 3'UTR Luciferase Stable Cell Line

TU008682 1.0 ml
EUR 1394

Gcm2 3'UTR Luciferase Stable Cell Line

TU106974 1.0 ml Ask for price

GCM2 3'UTR GFP Stable Cell Line

TU058682 1.0 ml
EUR 1394

Gcm2 3'UTR GFP Stable Cell Line

TU255007 1.0 ml Ask for price

GCM2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV624049 1.0 ug DNA
EUR 682

GCM2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV624053 1.0 ug DNA
EUR 682

GCM2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV624054 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody

ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

GCM2 Rabbit Polyclonal Antibody

Back To Top