GRB7 Rabbit Polyclonal Antibody

GRB7 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

GRB7 Polyclonal Antibody

ES8778-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against GRB7 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

GRB7 Rabbit pAb

A5690-100ul 100 ul
EUR 308

GRB7 Rabbit pAb

A5690-200ul 200 ul
EUR 459

GRB7 Rabbit pAb

A5690-20ul 20 ul
EUR 183

GRB7 Rabbit pAb

A5690-50ul 50 ul
EUR 223

GRB7 antibody

70R-17597 50 ul
EUR 435
Description: Rabbit polyclonal GRB7 antibody

GRB7 antibody

70R-14126 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal GRB7 antibody

GRB7 Antibody

32977-100ul 100ul
EUR 252

GRB7 Antibody

DF8092 200ul
EUR 304
Description: GRB7 Antibody detects endogenous levels of total GRB7.

GRB7 Antibody

1-CSB-PA228050
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GRB7. Recognizes GRB7 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

GRB7 antibody

70R-35016 100 ug
EUR 349
Description: Purified Rabbit polyclonal GRB7 antibody

GRB7 Antibody

1-CSB-PA009890ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GRB7. Recognizes GRB7 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

GRB7 Antibody

1-CSB-PA009890ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GRB7. Recognizes GRB7 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GRB7 Antibody

1-CSB-PA009890GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Protein A Purified
Description: A polyclonal antibody against GRB7. Recognizes GRB7 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GRB7 Antibody

ABD8092 100 ug
EUR 438

Rabbit Grb7 ELISA Kit

ERTG0257 96Tests
EUR 521

GRB7 Conjugated Antibody

C32977 100ul
EUR 397

anti- GRB7 antibody

FNab03643 100µg
EUR 548.75
  • Immunogen: growth factor receptor-bound protein 7
  • Uniprot ID: Q14451
  • Gene ID: 2886
  • Research Area: Cardiovascular, Signal Transduction
Description: Antibody raised against GRB7

Anti-GRB7 Antibody

PA1589 100ug/vial
EUR 334

Anti-GRB7 Antibody

PA1589-1 100ug/vial
EUR 334

Anti-GRB7 antibody

PAab03643 100 ug
EUR 386

Anti-GRB7 antibody

STJ27657 100 µl
EUR 277
Description: The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with epidermal growth factor receptor (EGFR) and ephrin receptors. The protein plays a role in the integrin signaling pathway and cell migration by binding with focal adhesion kinase (FAK). Several transcript variants encoding two different isoforms have been found for this gene.

Anti-GRB7 antibody

STJ98983 200 µl
EUR 197
Description: Rabbit polyclonal to GRB7.

Grb7/ Rat Grb7 ELISA Kit

ELI-47995r 96 Tests
EUR 886

Polyclonal Goat Anti-GRB7 (N Terminus) Antibody

APR16287G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GRB7 (N Terminus) . This antibody is tested and proven to work in the following applications:

GRB7 siRNA

20-abx902307
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRB7 siRNA

20-abx918649
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GRB7 siRNA

20-abx918650
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-GRB7

PVT12198 2 ug
EUR 391

anti-GRB7

YF-PA12115 50 ul
EUR 363
Description: Mouse polyclonal to GRB7

anti-GRB7

YF-PA12116 50 ug
EUR 363
Description: Mouse polyclonal to GRB7

anti-GRB7

YF-PA12117 100 ul
EUR 403
Description: Rabbit polyclonal to GRB7

anti-GRB7

YF-PA12118 100 ug
EUR 403
Description: Rabbit polyclonal to GRB7

GRB7 Blocking Peptide

DF8092-BP 1mg
EUR 195

GRB7 cloning plasmid

CSB-CL009890HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1599
  • Sequence: atggagctggatctgtctccacctcatcttagcagctctccggaagacctttgcccagcccctgggacccctcctgggactccccggccccctgatacccctctgcctgaggaggtaaagaggtcccagcctctcctcatcccaaccaccggcaggaaacttcgagaggaggaga
  • Show more
Description: A cloning plasmid for the GRB7 gene.

Anti-GRB7 (3C12)

YF-MA13319 100 ug
EUR 363
Description: Mouse monoclonal to GRB7

Anti-GRB7 (N Terminus) antibody

STJ70165 100 µg
EUR 359

Human Grb7 ELISA Kit

EHG0257 96Tests
EUR 521

Goat Grb7 ELISA Kit

EGTG0257 96Tests
EUR 521

Bovine Grb7 ELISA Kit

EBG0257 96Tests
EUR 521

Canine Grb7 ELISA Kit

ECG0257 96Tests
EUR 521

Anserini Grb7 ELISA Kit

EAG0257 96Tests
EUR 521

GRB7 ELISA KIT|Human

EF009989 96 Tests
EUR 689

Rat GRB7 shRNA Plasmid

20-abx986938
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GRB7 shRNA Plasmid

20-abx951940
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GRB7 Rabbit Polyclonal Antibody

Back To Top