GSTA1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
GSTA1 Polyclonal Antibody |
A62710 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
GSTA1 Polyclonal Antibody |
ABP58728-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140
- Applications tips:
|
Description: A polyclonal antibody for detection of GSTA1 from Human. This GSTA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140 |
GSTA1 Polyclonal Antibody |
ABP58728-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140
- Applications tips:
|
Description: A polyclonal antibody for detection of GSTA1 from Human. This GSTA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140 |
GSTA1 Polyclonal Antibody |
ABP58728-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140
- Applications tips:
|
Description: A polyclonal antibody for detection of GSTA1 from Human. This GSTA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140 |
GSTA1 Polyclonal Antibody |
ES8739-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against GSTA1 from Human. This antibody is tested and validated for IHC, WB, ELISA |
GSTA1 Polyclonal Antibody |
ES8739-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against GSTA1 from Human. This antibody is tested and validated for IHC, WB, ELISA |
GSTA1 Rabbit pAb |
A1628-100ul |
Abclonal |
100 ul |
EUR 308 |
GSTA1 Rabbit pAb |
A1628-200ul |
Abclonal |
200 ul |
EUR 459 |
GSTA1 Rabbit pAb |
A1628-20ul |
Abclonal |
20 ul |
EUR 183 |
GSTA1 Rabbit pAb |
A1628-50ul |
Abclonal |
50 ul |
EUR 223 |
GSTA1 Rabbit pAb |
A18266-100ul |
Abclonal |
100 ul |
EUR 308 |
GSTA1 Rabbit pAb |
A18266-200ul |
Abclonal |
200 ul |
EUR 459 |
GSTA1 Rabbit pAb |
A18266-20ul |
Abclonal |
20 ul |
EUR 183 |
GSTA1 Rabbit pAb |
A18266-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
DLR-GSTa1-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
DLR-GSTa1-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
DLR-GSTa1-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma or other biological fluids. |
Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
DLR-GSTa1-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma or other biological fluids. |
Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
DLR-GSTa1-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
DLR-GSTa1-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RDR-GSTa1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RDR-GSTa1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RDR-GSTa1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RDR-GSTa1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RDR-GSTa1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RDR-GSTa1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RD-GSTa1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RD-GSTa1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RD-GSTa1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RD-GSTa1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RD-GSTa1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit |
RD-GSTa1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rabbit GSTa1 ELISA Kit |
ERTG0274 |
Abclonal |
96Tests |
EUR 521 |
GSTA1 Polyclonal Antibody, HRP Conjugated |
A62711 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
GSTA1 Polyclonal Antibody, FITC Conjugated |
A62712 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
GSTA1 Polyclonal Antibody, Biotin Conjugated |
A62713 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
GSTA1 antibody |
22536-100ul |
SAB |
100ul |
EUR 390 |
GSTA1 antibody |
70R-17620 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal GSTA1 antibody |
GSTA1 antibody |
70R-13136 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal GSTA1 antibody |
GSTA1 Antibody |
32353-100ul |
SAB |
100ul |
EUR 252 |
GSTA1 Antibody |
DF6514 |
Affbiotech |
200ul |
EUR 304 |
Description: GSTA1 Antibody detects endogenous levels of total GSTA1. |
GSTA1 Antibody |
1-CSB-PA009970GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF |
GSTA1 Antibody |
1-CSB-PA009970HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
Gsta1 Antibody |
1-CSB-PA009970HA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
GSTA1 Antibody |
1-CSB-PA009970LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
Human GSTA1 Antibody |
32238-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-GSTA1 Antibody |
A01462 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for GSTA1 Antibody (GSTA1) detection.tested for IHC in Human. |
GSTA1 Conjugated Antibody |
C32353 |
SAB |
100ul |
EUR 397 |
anti- GSTA1 antibody |
FNab03686 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:2000
- IP: 1:500-1:1000
- IHC: 1:200-1:500
- IF: 1:10-1:100
- Immunogen: glutathione S-transferase alpha 1
- Uniprot ID: P08263
- Gene ID: 2938
- Research Area: Metabolism
|
Description: Antibody raised against GSTA1 |
Anti-GSTA1 antibody |
STJ11100222 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants. |
Anti-GSTA1 antibody |
STJ23884 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants. |
Anti-GSTA1 antibody |
STJ98802 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to GSTA1. |
GSTA1 protein |
30R-1443 |
Fitzgerald |
100 ug |
EUR 268 |
Description: Purified recombinant Human GSTA1 protein |
GSTA1 protein |
80R-4224 |
Fitzgerald |
50 ug |
EUR 349 |
Description: Recombinant Mouse GSTA1 protein with His tag |
GSTA1 siRNA |
20-abx902348 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GSTA1 siRNA |
20-abx918803 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GSTA1 siRNA |
20-abx918804 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
GSTA1 Antibody, HRP conjugated |
1-CSB-PA009970HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
Gsta1 Antibody, HRP conjugated |
1-CSB-PA009970HB01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
GSTA1 Antibody, FITC conjugated |
1-CSB-PA009970HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
Gsta1 Antibody, FITC conjugated |
1-CSB-PA009970HC01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
GSTA1 Antibody, Biotin conjugated |
1-CSB-PA009970HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Gsta1 Antibody, Biotin conjugated |
1-CSB-PA009970HD01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
GSTA1 Antibody, HRP conjugated |
1-CSB-PA009970LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
GSTA1 Antibody, FITC conjugated |
1-CSB-PA009970LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
GSTA1 Antibody, Biotin conjugated |
1-CSB-PA009970LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Human Recombinant GSTA1 |
6346-100 |
Biovision |
|
EUR 425 |
GSTA1 Blocking Peptide |
DF6514-BP |
Affbiotech |
1mg |
EUR 195 |
GSTA1 cloning plasmid |
CSB-CL009970HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 669
- Sequence: atggcagagaagcccaagctccactacttcaatgcacggggcagaatggagtccacccggtggctcctggctgcagctggagtagagtttgaagagaaatttataaaatctgcagaagatttggacaagttaagaaatgatggatatttgatgttccagcaagtgccaatggttga
- Show more
|
Description: A cloning plasmid for the GSTA1 gene. |
Human GSTA1 Antibody (Biotin Conjugate) |
32238-05121 |
AssayPro |
150 ug |
EUR 369 |
Monoclonal GSTA1 Antibody, Clone: 286CT8.1.5 |
APR10881G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A Monoclonal antibody against Human GSTA1. The antibodies are raised in Mouse and are from clone 286CT8.1.5. This antibody is applicable in WB, E |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat) |
4-PAA609Ra01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ser2~Phe222)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1) |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse) |
4-PAA609Hu01 |
Cloud-Clone |
-
EUR 232.00
-
EUR 2285.00
-
EUR 574.00
-
EUR 289.00
-
EUR 208.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Phe222)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1) |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat) |
4-PAA609Mu01 |
Cloud-Clone |
-
EUR 236.00
-
EUR 2338.00
-
EUR 586.00
-
EUR 294.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Gln223)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1) |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), APC |
4-PAA609Ra01-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ser2~Phe222)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), Biotinylated |
4-PAA609Ra01-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ser2~Phe222)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Biotin. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), Cy3 |
4-PAA609Ra01-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ser2~Phe222)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Cy3. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), FITC |
4-PAA609Ra01-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ser2~Phe222)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with FITC. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), HRP |
4-PAA609Ra01-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ser2~Phe222)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with HRP. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), PE |
4-PAA609Ra01-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ser2~Phe222)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with PE. |
Human GSTA1 AssayLite Antibody (FITC Conjugate) |
32238-05141 |
AssayPro |
150 ug |
EUR 428 |
Human GSTA1 AssayLite Antibody (RPE Conjugate) |
32238-05151 |
AssayPro |
150 ug |
EUR 428 |
Human GSTA1 AssayLite Antibody (APC Conjugate) |
32238-05161 |
AssayPro |
150 ug |
EUR 428 |
Human GSTA1 AssayLite Antibody (PerCP Conjugate) |
32238-05171 |
AssayPro |
150 ug |
EUR 471 |
Monoclonal GSTA1 Antibody (ascites), Clone: 286CT8.1.5 |
AMM05230G |
Leading Biology |
0.1 ml |
EUR 484 |
Description: A Monoclonal antibody against Human GSTA1 (ascites). The antibodies are raised in Mouse and are from clone 286CT8.1.5. This antibody is applicable in WB, E |
Human GSTa1 ELISA Kit |
EHG0274 |
Abclonal |
96Tests |
EUR 521 |
Goat GSTa1 ELISA Kit |
EGTG0274 |
Abclonal |
96Tests |
EUR 521 |
Bovine GSTa1 ELISA Kit |
EBG0274 |
Abclonal |
96Tests |
EUR 521 |
Canine GSTa1 ELISA Kit |
ECG0274 |
Abclonal |
96Tests |
EUR 521 |
Chicken GSTa1 ELISA Kit |
ECKG0274 |
Abclonal |
96Tests |
EUR 521 |
Anserini GSTa1 ELISA Kit |
EAG0274 |
Abclonal |
96Tests |
EUR 521 |
Rat GSTA1 shRNA Plasmid |
20-abx984487 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human GSTA1 shRNA Plasmid |
20-abx951986 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse GSTA1 shRNA Plasmid |
20-abx970685 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse GSTa1 ELISA Kit |
EMG0274 |
Abclonal |
96Tests |
EUR 521 |
Rat GSTa1 ELISA Kit |
ERG0274 |
Abclonal |
96Tests |
EUR 521 |
Sheep GSTa1 ELISA Kit |
ESG0274 |
Abclonal |
96Tests |
EUR 521 |
Monkey GSTa1 ELISA Kit |
EMKG0274 |
Abclonal |
96Tests |
EUR 521 |
Porcine GSTa1 ELISA Kit |
EPG0274 |
Abclonal |
96Tests |
EUR 521 |
GSTA1 Recombinant Protein (Human) |
RP014101 |
ABM |
100 ug |
Ask for price |
GSTA1 Recombinant Protein (Mouse) |
RP140231 |
ABM |
100 ug |
Ask for price |
Rabbit Glutathione S Transferase Alpha 1 (GSTA1) ELISA Kit |
abx363363-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), APC |
4-PAA609Hu01-APC |
Cloud-Clone |
-
EUR 323.00
-
EUR 2969.00
-
EUR 836.00
-
EUR 409.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Phe222)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), Biotinylated |
4-PAA609Hu01-Biotin |
Cloud-Clone |
-
EUR 295.00
-
EUR 2235.00
-
EUR 671.00
-
EUR 358.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Phe222)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Biotin. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), Cy3 |
4-PAA609Hu01-Cy3 |
Cloud-Clone |
-
EUR 390.00
-
EUR 3917.00
-
EUR 1073.00
-
EUR 504.00
-
EUR 239.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Phe222)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Cy3. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), FITC |
4-PAA609Hu01-FITC |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Phe222)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with FITC. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), HRP |
4-PAA609Hu01-HRP |
Cloud-Clone |
-
EUR 297.00
-
EUR 2589.00
-
EUR 741.00
-
EUR 371.00
-
EUR 199.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Phe222)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with HRP. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), PE |
4-PAA609Hu01-PE |
Cloud-Clone |
-
EUR 279.00
-
EUR 2395.00
-
EUR 688.00
-
EUR 347.00
-
EUR 188.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Phe222)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with PE. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), APC |
4-PAA609Mu01-APC |
Cloud-Clone |
-
EUR 329.00
-
EUR 3041.00
-
EUR 854.00
-
EUR 416.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Gln223)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAA609Mu01-Biotin |
Cloud-Clone |
-
EUR 299.00
-
EUR 2288.00
-
EUR 684.00
-
EUR 363.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Gln223)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Biotin. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAA609Mu01-Cy3 |
Cloud-Clone |
-
EUR 397.00
-
EUR 4013.00
-
EUR 1097.00
-
EUR 513.00
-
EUR 241.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Gln223)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Cy3. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAA609Mu01-FITC |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Gln223)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with FITC. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAA609Mu01-HRP |
Cloud-Clone |
-
EUR 302.00
-
EUR 2652.00
-
EUR 756.00
-
EUR 377.00
-
EUR 200.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Gln223)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with HRP. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), PE |
4-PAA609Mu01-PE |
Cloud-Clone |
-
EUR 283.00
-
EUR 2452.00
-
EUR 703.00
-
EUR 353.00
-
EUR 189.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Gln223)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with PE. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAA609Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ser2~Phe222)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC-Cy7. |
Mouse Glutathione S-Transferase A1 (GSTA1) Antibody |
32145-05111 |
AssayPro |
150 ug |
EUR 261 |
Anti-GSTA1/A2/A3/A4/A5 Antibody |
A01462-1 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-GSTA1/A2/A3/A4/A5 Antibody |
A01462-2 |
BosterBio |
100ug/vial |
EUR 294 |
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
abx025297-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
abx025298-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
abx025298-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody |
20-abx176658 |
Abbexa |
|
|
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody |
20-abx103585 |
Abbexa |
-
EUR 398.00
-
EUR 133.00
-
EUR 1107.00
-
EUR 537.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody |
20-abx103586 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1135.00
-
EUR 551.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody |
20-abx103587 |
Abbexa |
-
EUR 314.00
-
EUR 787.00
-
EUR 411.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody |
20-abx103588 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Glutathione S-Transferase Alpha-1 (GSTA1) Antibody |
20-abx112771 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody |
20-abx172610 |
Abbexa |
|
|
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
abx034069-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
abx034069-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
abx340021-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
abx233686-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
20-abx317876 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
20-abx301201 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
20-abx225204 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Monoclonal GSTA1 Antibody (clone 2F7), Clone: 2F7 |
AMM05231G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human GSTA1 (clone 2F7). The antibodies are raised in Mouse and are from clone 2F7. This antibody is applicable in WB and IHC-P, E |
Monoclonal GSTA1 Antibody (monoclonal) (M01), Clone: 2F7 |
AMM05232G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human GSTA1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F7. This antibody is applicable in WB and IHC, E |
Monoclonal GSTA1 Antibody (monoclonal) (M08), Clone: 1F9 |
AMM05233G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human GSTA1 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 1F9. This antibody is applicable in WB, E |
Glutathione S Transferase Alpha 1 (GSTA1) Antibody |
20-abx001371 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Anti-GSTA1/GSTA2/GSTA3/GSTA4/GSTA5 Antibody |
PB9627 |
BosterBio |
100ug/vial |
EUR 294 |
Guinea Pig GSTa1 ELISA Kit |
EGG0274 |
Abclonal |
96Tests |
EUR 521 |
GSTA1 ORF Vector (Human) (pORF) |
ORF004701 |
ABM |
1.0 ug DNA |
EUR 95 |
Gsta1 ORF Vector (Mouse) (pORF) |
ORF046745 |
ABM |
1.0 ug DNA |
EUR 506 |
GSTA1 ELISA Kit (Mouse) (OKCD00806) |
OKCD00806 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL |
GSTA1 ELISA Kit (Human) (OKCD01133) |
OKCD01133 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.1 Publication
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.23"The role of a topologically conserved isoleucine in glutathione transferase structure, stability and function."_x005F_x005F_x000D_Achilonu I., Gildenhuys S., Fisher L., Burke J., Fanucchi S., Sewell B.T., Fernandes M., Dirr H.W._x005F_x005F_x000D_Acta Crystallogr. F 66:776-780(2010) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.75 ANGSTROMS) OF MUTANTS ALA-71 AND VAL-71 IN COMPLEX WITH S-HEXYLGLUTATHIONE, FUNCTION, CATALYTIC ACTIVITY, MUTAGENESIS OF ILE-71. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 24.7 pg/mL |
Gsta1 ELISA Kit (Rat) (OKCD01529) |
OKCD01529 |
Aviva Systems Biology |
96 Wells |
EUR 818 |
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.133 ng/mL |
GSTA1 ELISA Kit (Human) (OKBB01139) |
OKBB01139 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: GSTA encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml |
GSTA1 ELISA Kit (Human) (OKEH08708) |
OKEH08708 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35pg/mL |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), APC-Cy7 |
4-PAA609Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 527.00
-
EUR 5818.00
-
EUR 1552.00
-
EUR 698.00
-
EUR 301.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Phe222)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC-Cy7. |
Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), APC-Cy7 |
4-PAA609Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 538.00
-
EUR 5962.00
-
EUR 1588.00
-
EUR 713.00
-
EUR 304.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: GSTa1 (Ala2~Gln223)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC-Cy7. |
Anti-GSTA1/A2/A3/A4/A5 Biotinylated Antibody |
A01462-Biotin |
BosterBio |
50ug/vial |
EUR 294 |
Glutathione S Transferase Alpha 1 (GSTa1) Antibody (Biotin) |
20-abx272015 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1191.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody (Biotin) |
20-abx272717 |
Abbexa |
-
EUR 425.00
-
EUR 230.00
-
EUR 1219.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody (Biotin) |
20-abx273191 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody (FITC) |
20-abx273776 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1288.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody (FITC) |
20-abx273992 |
Abbexa |
-
EUR 453.00
-
EUR 244.00
-
EUR 1316.00
-
EUR 634.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Alpha 1 (GSTa1) Antibody (FITC) |
20-abx274128 |
Abbexa |
-
EUR 467.00
-
EUR 244.00
-
EUR 1386.00
-
EUR 648.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody (HRP) |
20-abx304090 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody (FITC) |
20-abx304091 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody (Biotin) |
20-abx304092 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody (HRP) |
20-abx314149 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody (FITC) |
20-abx314150 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Glutathione S Transferase Alpha 1 (GSTA1) Antibody (Biotin) |
20-abx314151 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Gsta1 sgRNA CRISPR Lentivector set (Mouse) |
K3344401 |
ABM |
3 x 1.0 ug |
EUR 339 |
GSTA1 sgRNA CRISPR Lentivector set (Human) |
K0912601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mouse Glutathione S-Transferase A1 (GSTA1) Antibody (Biotin Conjugate) |
32145-05121 |
AssayPro |
150 ug |
EUR 369 |
Glutathione S Transferase Alpha 1 (GSTa1) Monoclonal Antibody (Human) |
4-MAA609Hu22 |
Cloud-Clone |
-
EUR 241.00
-
EUR 2417.00
-
EUR 604.00
-
EUR 301.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: Ala2~Phe222
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Mouse monoclonal antibody against Human Glutathione S Transferase Alpha 1 (GSTa1) |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
GSTA1 Rabbit Polyclonal Antibody