GSTA1 Rabbit Polyclonal Antibody

GSTA1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

GSTA1 Polyclonal Antibody
ABP58728-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140 Applications tips:
Description: A polyclonal antibody for detection of GSTA1 from Human. This GSTA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140

GSTA1 Polyclonal Antibody
ABP58728-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140 Applications tips:
Description: A polyclonal antibody for detection of GSTA1 from Human. This GSTA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140

GSTA1 Polyclonal Antibody
ABP58728-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140 Applications tips:
Description: A polyclonal antibody for detection of GSTA1 from Human. This GSTA1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GSTA1 protein at amino acid sequence of 91-140

GSTA1 Polyclonal Antibody
A62710	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GSTA1 Polyclonal Antibody
46859-100ul	SAB	100ul	EUR 252

GSTA1 Polyclonal Antibody
46859-50ul	SAB	50ul	EUR 187

GSTA1 Rabbit pAb
A18266-100ul	Abclonal	100 ul	EUR 308

GSTA1 Rabbit pAb
A18266-200ul	Abclonal	200 ul	EUR 459

GSTA1 Rabbit pAb
A18266-20ul	Abclonal	20 ul	EUR 183

GSTA1 Rabbit pAb
A18266-50ul	Abclonal	50 ul	EUR 223

GSTA1 Rabbit pAb
A1628-100ul	Abclonal	100 ul	EUR 308

GSTA1 Rabbit pAb
A1628-200ul	Abclonal	200 ul	EUR 459

GSTA1 Rabbit pAb
A1628-20ul	Abclonal	20 ul	EUR 183

GSTA1 Rabbit pAb
A1628-50ul	Abclonal	50 ul	EUR 223

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
DLR-GSTa1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
DLR-GSTa1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
DLR-GSTa1-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma or other biological fluids.

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
DLR-GSTa1-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma or other biological fluids.

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
DLR-GSTa1-Ra-48T	DL Develop	48T	EUR 508
Should the Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
DLR-GSTa1-Ra-96T	DL Develop	96T	EUR 661
Should the Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Glutathione S Transferase Alpha 1 (GSTa1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RD-GSTa1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RD-GSTa1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RD-GSTa1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RD-GSTa1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RD-GSTa1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 511

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RD-GSTa1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 709

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RDR-GSTa1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RDR-GSTa1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RDR-GSTa1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RDR-GSTa1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RDR-GSTa1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Glutathione S Transferase Alpha 1 (GSTa1) ELISA Kit
RDR-GSTa1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Rabbit GSTa1 ELISA Kit
ERTG0274	Abclonal	96Tests	EUR 521

GSTA1 Polyclonal Antibody, HRP Conjugated
A62711	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GSTA1 Polyclonal Antibody, FITC Conjugated
A62712	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GSTA1 Polyclonal Antibody, Biotin Conjugated
A62713	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GSTA1 Antibody
ABD6514	Lifescience Market	100 ug	EUR 438

GSTA1 Antibody
32353-100ul	SAB	100ul	EUR 252

GSTA1 antibody
22536-100ul	SAB	100ul	EUR 390

GSTA1 antibody
70R-17620	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal GSTA1 antibody

GSTA1 antibody
70R-13136	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal GSTA1 antibody

GSTA1 Antibody
DF6514	Affbiotech	200ul	EUR 304
Description: GSTA1 Antibody detects endogenous levels of total GSTA1.

GSTA1 Antibody
1-CSB-PA009970GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

GSTA1 Antibody
1-CSB-PA009970HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

Gsta1 Antibody
1-CSB-PA009970HA01MO	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

GSTA1 Antibody
1-CSB-PA009970LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GSTA1 Conjugated Antibody
C32353	SAB	100ul	EUR 397

anti- GSTA1 antibody
FNab03686	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:1000 IHC: 1:200-1:500 IF: 1:10-1:100 Immunogen: glutathione S-transferase alpha 1 Uniprot ID: P08263 Gene ID: 2938 Research Area: Metabolism
Description: Antibody raised against GSTA1

Anti-GSTA1 Antibody
A01462	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for GSTA1 Antibody (GSTA1) detection.tested for IHC in Human.

Human GSTA1 Antibody
32238-05111	AssayPro	150 ug	EUR 261

Anti-GSTA1 antibody
PAab03686	Lifescience Market	100 ug	EUR 355

Anti-GSTA1 antibody
STJ98802	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to GSTA1.

Anti-GSTA1 antibody
STJ11100222	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.

Anti-GSTA1 antibody
STJ23884	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.

Gsta1/ Rat Gsta1 ELISA Kit
ELI-19370r	Lifescience Market	96 Tests	EUR 886

GSTA1 siRNA
20-abx902348	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTA1 siRNA
20-abx918803	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTA1 siRNA
20-abx918804	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTA1 protein
80R-4224	Fitzgerald	50 ug	EUR 349
Description: Recombinant Mouse GSTA1 protein with His tag

GSTA1 protein
30R-1443	Fitzgerald	100 ug	EUR 268
Description: Purified recombinant Human GSTA1 protein

GSTA1 Antibody, HRP conjugated
1-CSB-PA009970HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

Gsta1 Antibody, HRP conjugated
1-CSB-PA009970HB01MO	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

GSTA1 Antibody, FITC conjugated
1-CSB-PA009970HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Gsta1 Antibody, FITC conjugated
1-CSB-PA009970HC01MO	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

GSTA1 Antibody, Biotin conjugated
1-CSB-PA009970HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Gsta1 Antibody, Biotin conjugated
1-CSB-PA009970HD01MO	Cusabio	EUR 317.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gsta1. Recognizes Gsta1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

GSTA1 Antibody, HRP conjugated
1-CSB-PA009970LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GSTA1 Antibody, FITC conjugated
1-CSB-PA009970LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GSTA1 Antibody, Biotin conjugated
1-CSB-PA009970LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GSTA1. Recognizes GSTA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Monoclonal GSTA1 Antibody, Clone: 286CT8.1.5
APR10881G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human GSTA1. The antibodies are raised in Mouse and are from clone 286CT8.1.5. This antibody is applicable in WB, E

Human GSTA1 Antibody (Biotin Conjugate)
32238-05121	AssayPro	150 ug	EUR 369

GSTA1 cloning plasmid
CSB-CL009970HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 669 Sequence: atggcagagaagcccaagctccactacttcaatgcacggggcagaatggagtccacccggtggctcctggctgcagctggagtagagtttgaagagaaatttataaaatctgcagaagatttggacaagttaagaaatgatggatatttgatgttccagcaagtgccaatggttga Show more
Description: A cloning plasmid for the GSTA1 gene.

Human Recombinant GSTA1
6346-100	Biovision		EUR 425

GSTA1 Blocking Peptide
DF6514-BP	Affbiotech	1mg	EUR 195

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat)
4-PAA609Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ser2~Phe222) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1)

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse)
4-PAA609Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Phe222) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1)

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat)
4-PAA609Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Gln223) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1)

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), APC
4-PAA609Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ser2~Phe222) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), Biotinylated
4-PAA609Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ser2~Phe222) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Biotin.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), Cy3
4-PAA609Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ser2~Phe222) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Cy3.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), FITC
4-PAA609Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ser2~Phe222) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with FITC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), HRP
4-PAA609Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ser2~Phe222) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with HRP.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), PE
4-PAA609Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ser2~Phe222) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with PE.

Monoclonal GSTA1 Antibody (ascites), Clone: 286CT8.1.5
AMM05230G	Leading Biology	0.1 ml	EUR 484
Description: A Monoclonal antibody against Human GSTA1 (ascites). The antibodies are raised in Mouse and are from clone 286CT8.1.5. This antibody is applicable in WB, E

Human GSTA1 AssayLite Antibody (FITC Conjugate)
32238-05141	AssayPro	150 ug	EUR 428

Human GSTA1 AssayLite Antibody (RPE Conjugate)
32238-05151	AssayPro	150 ug	EUR 428

Human GSTA1 AssayLite Antibody (APC Conjugate)
32238-05161	AssayPro	150 ug	EUR 428

Human GSTA1 AssayLite Antibody (PerCP Conjugate)
32238-05171	AssayPro	150 ug	EUR 471

Rat GSTA1 shRNA Plasmid
20-abx984487	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GSTa1 ELISA Kit
EHG0274	Abclonal	96Tests	EUR 521

Goat GSTa1 ELISA Kit
EGTG0274	Abclonal	96Tests	EUR 521

Canine GSTa1 ELISA Kit
ECG0274	Abclonal	96Tests	EUR 521

Chicken GSTa1 ELISA Kit
ECKG0274	Abclonal	96Tests	EUR 521

Bovine GSTa1 ELISA Kit
EBG0274	Abclonal	96Tests	EUR 521

Anserini GSTa1 ELISA Kit
EAG0274	Abclonal	96Tests	EUR 521

Porcine GSTa1 ELISA Kit
EPG0274	Abclonal	96Tests	EUR 521

Rat GSTa1 ELISA Kit
ERG0274	Abclonal	96Tests	EUR 521

Sheep GSTa1 ELISA Kit
ESG0274	Abclonal	96Tests	EUR 521

Mouse GSTa1 ELISA Kit
EMG0274	Abclonal	96Tests	EUR 521

Monkey GSTa1 ELISA Kit
EMKG0274	Abclonal	96Tests	EUR 521

Mouse GSTA1 shRNA Plasmid
20-abx970685	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GSTA1 shRNA Plasmid
20-abx951986	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GSTA1 Recombinant Protein (Human)
RP014101	ABM	100 ug	Ask for price

pCMV-SPORT6-GSTA1 Plasmid
PVT16049	Lifescience Market	2 ug	EUR 325

GSTA1 Recombinant Protein (Mouse)
RP140231	ABM	100 ug	Ask for price

Rabbit Glutathione S Transferase Alpha 1 (GSTA1) ELISA Kit
abx363363-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), APC
4-PAA609Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Phe222) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA609Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Phe222) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Biotin.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA609Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Phe222) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Cy3.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), FITC
4-PAA609Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Phe222) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with FITC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), HRP
4-PAA609Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Phe222) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with HRP.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), PE
4-PAA609Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Phe222) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with PE.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), APC
4-PAA609Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Gln223) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAA609Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Gln223) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Biotin.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAA609Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Gln223) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with Cy3.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), FITC
4-PAA609Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Gln223) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with FITC.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), HRP
4-PAA609Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Gln223) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with HRP.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), PE
4-PAA609Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Gln223) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with PE.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Rat), APC-Cy7
4-PAA609Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ser2~Phe222) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC-Cy7.

Monoclonal GSTA1 Antibody (clone 2F7), Clone: 2F7
AMM05231G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human GSTA1 (clone 2F7). The antibodies are raised in Mouse and are from clone 2F7. This antibody is applicable in WB and IHC-P, E

Monoclonal GSTA1 Antibody (monoclonal) (M01), Clone: 2F7
AMM05232G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human GSTA1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2F7. This antibody is applicable in WB and IHC, E

Monoclonal GSTA1 Antibody (monoclonal) (M08), Clone: 1F9
AMM05233G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human GSTA1 (monoclonal) (M08). The antibodies are raised in mouse and are from clone 1F9. This antibody is applicable in WB, E

Glutathione S-Transferase Alpha-1 (GSTA1) Antibody
20-abx112771	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
20-abx001371	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody
20-abx103585	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody
20-abx103586	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody
20-abx103587	Abbexa	EUR 314.00 EUR 787.00 EUR 411.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody
20-abx103588	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
abx034069-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
abx034069-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
abx025297-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
abx025298-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
abx025298-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody
20-abx172610	Abbexa	EUR 843.00 EUR 439.00	1 mg 200 ug
Please enquire.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody
20-abx176658	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
abx340021-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
20-abx317876	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
abx233686-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
20-abx301201	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody
20-abx225204	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Anti-GSTA1/A2/A3/A4/A5 Antibody
A01462-1	BosterBio	100ug/vial	EUR 334

Anti-GSTA1/A2/A3/A4/A5 Antibody
A01462-2	BosterBio	100ug/vial	EUR 294

Mouse Glutathione S-Transferase A1 (GSTA1) Antibody
32145-05111	AssayPro	150 ug	EUR 261

Anti-GSTA1/GSTA2/GSTA3/GSTA4/GSTA5 Antibody
PB9627	BosterBio	100ug/vial	EUR 294

Guinea Pig GSTa1 ELISA Kit
EGG0274	Abclonal	96Tests	EUR 521

GSTA1 ORF Vector (Human) (pORF)
ORF004701	ABM	1.0 ug DNA	EUR 95

Gsta1 ORF Vector (Mouse) (pORF)
ORF046745	ABM	1.0 ug DNA	EUR 506

GSTA1 ELISA Kit (Mouse) (OKCD00806)
OKCD00806	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL

GSTA1 ELISA Kit (Human) (OKCD01133)
OKCD01133	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.23"The role of a topologically conserved isoleucine in glutathione transferase structure, stability and function."_x005F_x005F_x000D_Achilonu I., Gildenhuys S., Fisher L., Burke J., Fanucchi S., Sewell B.T., Fernandes M., Dirr H.W._x005F_x005F_x000D_Acta Crystallogr. F 66:776-780(2010) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.75 ANGSTROMS) OF MUTANTS ALA-71 AND VAL-71 IN COMPLEX WITH S-HEXYLGLUTATHIONE, FUNCTION, CATALYTIC ACTIVITY, MUTAGENESIS OF ILE-71. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 24.7 pg/mL

Gsta1 ELISA Kit (Rat) (OKCD01529)
OKCD01529	Aviva Systems Biology	96 Wells	EUR 818
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.133 ng/mL

GSTA1 ELISA Kit (Human) (OKBB01139)
OKBB01139	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: GSTA encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

GSTA1 ELISA Kit (Human) (OKEH08708)
OKEH08708	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene encodes a member of a family of enzymes that function to add glutathione to target electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins, and products of oxidative stress. This action is an important step in detoxification of these compounds. This subfamily of enzymes has a particular role in protecting cells from reactive oxygen species and the products of peroxidation. Polymorphisms in this gene influence the ability of individuals to metabolize different drugs. This gene is located in a cluster of similar genes and pseudogenes on chromosome 6. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35pg/mL

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAA609Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Phe222) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Alpha 1 (GSTa1) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAA609Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTa1 (Ala2~Gln223) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Glutathione S Transferase Alpha 1 (GSTa1). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (FITC)
20-abx273776	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (FITC)
20-abx273992	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (FITC)
20-abx274128	Abbexa	EUR 467.00 EUR 244.00 EUR 1386.00 EUR 648.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (HRP)
20-abx314149	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (FITC)
20-abx314150	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (Biotin)
20-abx314151	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (Biotin)
20-abx272015	Abbexa	EUR 425.00 EUR 230.00 EUR 1191.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (Biotin)
20-abx272717	Abbexa	EUR 425.00 EUR 230.00 EUR 1219.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTa1) Antibody (Biotin)
20-abx273191	Abbexa	EUR 453.00 EUR 244.00 EUR 1288.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (HRP)
20-abx304090	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (FITC)
20-abx304091	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glutathione S Transferase Alpha 1 (GSTA1) Antibody (Biotin)
20-abx304092	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-GSTA1/A2/A3/A4/A5 Biotinylated Antibody
A01462-Biotin	BosterBio	50ug/vial	EUR 294

GSTA1 sgRNA CRISPR Lentivector set (Human)
K0912601	ABM	3 x 1.0 ug	EUR 339

Gsta1 sgRNA CRISPR Lentivector set (Mouse)
K3344401	ABM	3 x 1.0 ug	EUR 339

pCDH-CMV-GSTA1-EF1-copGFP Plasmid
PVT16093	Lifescience Market	2 ug	EUR 325

Mouse Glutathione S-Transferase A1 (GSTA1) Antibody (Biotin Conjugate)
32145-05121	AssayPro	150 ug	EUR 369

Glutathione S Transferase Alpha 1 (GSTa1) Monoclonal Antibody (Human)
4-MAA609Hu22	Cloud-Clone	EUR 241.00 EUR 2417.00 EUR 604.00 EUR 301.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ala2~Phe222 Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Glutathione S Transferase Alpha 1 (GSTa1)

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

GSTA1 Rabbit Polyclonal Antibody