HDGF Rabbit Polyclonal Antibody

HDGF Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

HDGF Polyclonal Antibody
ABP58763-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190 Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

HDGF Polyclonal Antibody
ABP58763-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190 Applications tips:
Description: A polyclonal antibody for detection of HDGF from Human. This HDGF antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HDGF protein at amino acid sequence of 141-190

HDGF Polyclonal Antibody
A53048	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

HDGF Polyclonal Antibody
46852-100ul	SAB	100ul	EUR 252

HDGF Polyclonal Antibody
46852-50ul	SAB	50ul	EUR 187

HDGF Rabbit pAb
A5347-100ul	Abclonal	100 ul	EUR 308

HDGF Rabbit pAb
A5347-200ul	Abclonal	200 ul	EUR 459

HDGF Rabbit pAb
A5347-20ul	Abclonal	20 ul	EUR 183

HDGF Rabbit pAb
A5347-50ul	Abclonal	50 ul	EUR 223

HDGF Rabbit pAb
A13654-100ul	Abclonal	100 ul	EUR 308

HDGF Rabbit pAb
A13654-200ul	Abclonal	200 ul	EUR 459

HDGF Rabbit pAb
A13654-20ul	Abclonal	20 ul	EUR 183

HDGF Rabbit pAb
A13654-50ul	Abclonal	50 ul	EUR 223

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
DLR-HDGF-Hu-48T	DL Develop	48T	EUR 425
Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
DLR-HDGF-Hu-96T	DL Develop	96T	EUR 548
Should the Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
DLR-HDGF-Mu-48T	DL Develop	48T	EUR 435
Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
DLR-HDGF-Mu-96T	DL Develop	96T	EUR 561
Should the Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Hepatoma Derived Growth Factor (HDGF) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RD-HDGF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 418

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RD-HDGF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 575

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RD-HDGF-Mu-48Tests	Reddot Biotech	48 Tests	EUR 429

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RD-HDGF-Mu-96Tests	Reddot Biotech	96 Tests	EUR 591

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RDR-HDGF-Hu-48Tests	Reddot Biotech	48 Tests	EUR 436

Human Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RDR-HDGF-Hu-96Tests	Reddot Biotech	96 Tests	EUR 601

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RDR-HDGF-Mu-48Tests	Reddot Biotech	48 Tests	EUR 447

Mouse Hepatoma Derived Growth Factor (HDGF) ELISA Kit
RDR-HDGF-Mu-96Tests	Reddot Biotech	96 Tests	EUR 618

Rabbit HDGF ELISA Kit
ERTH0054	Abclonal	96Tests	EUR 521

Polyclonal HDGF Antibody (C-term)
APR05752G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal HDGF Antibody (C-term)
APR06952G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HDGF (C-term). This antibody is tested and proven to work in the following applications:

HDGF Polyclonal Antibody, HRP Conjugated
A53045	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

HDGF Polyclonal Antibody, FITC Conjugated
A53046	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

HDGF Polyclonal Antibody, Biotin Conjugated
A53047	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

HDGF Antibody
ABD7289	Lifescience Market	100 ug	EUR 438

HDGF Antibody
32788-100ul	SAB	100ul	EUR 252

HDGF antibody
10R-1523	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal HDGF antibody

HDGF antibody
70R-17711	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal HDGF antibody

HDGF Antibody
DF7289	Affbiotech	200ul	EUR 304
Description: HDGF Antibody detects endogenous levels of total HDGF.

HDGF Antibody
1-CSB-PA01004A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Unconjugated. Tested in the following application: ELISA

HDGF Antibody
1-CSB-PA010249GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HDGF Conjugated Antibody
C32788	SAB	100ul	EUR 397

anti- HDGF antibody
FNab03808	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: hepatoma-derived growth factor (high-mobility group protein 1-like) Uniprot ID: P51858 Gene ID: 3068 Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF

anti- HDGF antibody
FNab03809	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:1000-1:5000 IF: 1:10-1:100 IHC: 1:50-1:500 Immunogen: hepatoma-derived growth factor(high-mobility group protein 1-like) Uniprot ID: P51858 Gene ID: 81932 Research Area: Cancer, Signal Transduction, Metabolism
Description: Antibody raised against HDGF

Anti-HDGF Antibody
A01057	BosterBio	100ug/vial	EUR 334

Anti-HDGF antibody
PAab03808	Lifescience Market	100 ug	EUR 412

Anti-HDGF antibody
STJ98794	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to HDGF.

Anti-HDGF antibody
STJ27300	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Anti-HDGF antibody
STJ115610	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.

Hdgf/ Rat Hdgf ELISA Kit
ELI-38905r	Lifescience Market	96 Tests	EUR 886

HDGF siRNA
20-abx902439	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HDGF siRNA
20-abx919203	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HDGF siRNA
20-abx919204	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HDGF protein
30R-1402	Fitzgerald	100 ug	EUR 397
Description: Purified recombinant Human HDGF protein

pOTB7-HDGF
PVT14602	Lifescience Market	2 ug	EUR 495

anti-HDGF
YF-PA12275	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to HDGF

anti-HDGF
YF-PA23871	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to HDGF

HDGF Antibody, HRP conjugated
1-CSB-PA01004B0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HDGF Antibody, FITC conjugated
1-CSB-PA01004C0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HDGF Antibody, Biotin conjugated
1-CSB-PA01004D0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HDGF. Recognizes HDGF from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human)
4-PAA624Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Tyr10~Leu240) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF)

HDGF cloning plasmid
CSB-CL010249HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 723 Sequence: atgtcgcgatccaaccggcagaaggagtacaaatgcggggacctggtgttcgccaagatgaagggctacccacactggccggcccggattgacgagatgcctgaggctgccgtgaaatcaacagccaacaaataccaagtcttttttttcgggacccacgagacggcattcctggg Show more
Description: A cloning plasmid for the HDGF gene.

HDGF Blocking Peptide
DF7289-BP	Affbiotech	1mg	EUR 195

pOTB7-HDGF Plasmid
PVTB00247S	Lifescience Market	2 ug	EUR 356

Anti-HDGF (2D6)
YF-MA13429	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to HDGF

HDGF Like 3 (HDGFL3) Antibody
20-abx327580	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), APC
4-PAA624Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Tyr10~Leu240) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), Biotinylated
4-PAA624Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Tyr10~Leu240) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Biotin.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), Cy3
4-PAA624Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Tyr10~Leu240) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Cy3.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), FITC
4-PAA624Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Tyr10~Leu240) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with FITC.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), HRP
4-PAA624Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Tyr10~Leu240) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with HRP.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), PE
4-PAA624Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Tyr10~Leu240) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with PE.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse)
4-PAA624Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Asp14~Gly187) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF)

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human), APC-Cy7
4-PAA624Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Tyr10~Leu240) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC-Cy7.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), APC
4-PAA624Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Asp14~Gly187) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAA624Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Asp14~Gly187) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Biotin.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), Cy3
4-PAA624Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Asp14~Gly187) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with Cy3.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), FITC
4-PAA624Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Asp14~Gly187) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with FITC.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), HRP
4-PAA624Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Asp14~Gly187) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with HRP.

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), PE
4-PAA624Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Asp14~Gly187) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with PE.

Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx112980	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx128720	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx109863	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx103152	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody
abx032817-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody
abx032817-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx004089	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx172791	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx176825	Abbexa	EUR 1135.00 EUR 551.00	1 mg 200 ug
Please enquire.

Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx176826	Abbexa	EUR 1177.00 EUR 578.00	1 mg 200 ug
Please enquire.

Hepatoma Derived Growth Factor (HDGF) Antibody
abx233808-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody
abx233809-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody
20-abx225213	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Rat HDGF shRNA Plasmid
20-abx987193	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HDGF ELISA Kit
EHH0054	Abclonal	96Tests	EUR 521

Goat HDGF ELISA Kit
EGTH0054	Abclonal	96Tests	EUR 521

Bovine HDGF ELISA Kit
EBH0054	Abclonal	96Tests	EUR 521

Anserini HDGF ELISA Kit
EAH0054	Abclonal	96Tests	EUR 521

HDGF ELISA KIT|Human
EF010085	Lifescience Market	96 Tests	EUR 689

Porcine HDGF ELISA Kit
EPH0054	Abclonal	96Tests	EUR 521

Rat HDGF ELISA Kit
ERH0054	Abclonal	96Tests	EUR 521

Mouse HDGF ELISA Kit
EMH0054	Abclonal	96Tests	EUR 521

Mouse HDGF shRNA Plasmid
20-abx970772	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HDGF shRNA Plasmid
20-abx952089	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HDGF Recombinant Protein (Human)
RP014515	ABM	100 ug	Ask for price

pECMV-3-FLAG-HDGF
PVT14606	Lifescience Market	2 ug	EUR 495

HDGF Recombinant Protein (Rat)
RP204359	ABM	100 ug	Ask for price

HDGF Recombinant Protein (Mouse)
RP141161	ABM	100 ug	Ask for price

Hepatoma Derived Growth Factor (HDGF) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAA624Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HDGF (Asp14~Gly187) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Hepatoma Derived Growth Factor (HDGF). This antibody is labeled with APC-Cy7.

Hepatoma Derived Growth Factor (HDGF) Antibody (HRP)
20-abx108345	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody (Biotin)
20-abx105506	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Hepatoma Derived Growth Factor (HDGF) Antibody (FITC)
20-abx106923	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Hepatoma-Derived Growth Factor (HDGF) Antibody
32013-05111	AssayPro	150 ug	EUR 261

Guinea Pig HDGF ELISA Kit
EGH0054	Abclonal	96Tests	EUR 521

HDGF ORF Vector (Human) (pORF)
ORF004839	ABM	1.0 ug DNA	EUR 95

Hdgf ORF Vector (Rat) (pORF)
ORF068121	ABM	1.0 ug DNA	EUR 506

Hdgf ORF Vector (Mouse) (pORF)
ORF047055	ABM	1.0 ug DNA	EUR 506

pFastBac TM1 Signal-HDGF Plasmid
PVTB00247-2a	Lifescience Market	2 ug	EUR 356

HDGF ELISA Kit (Human) (OKCD00249)
OKCD00249	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Heparin-binding protein, with mitogenic activity for fibroblasts. Acts as a transcriptional repressor.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.11"Hepatoma-derived growth factor binds DNA through the N-terminal PWWP domain."_x005F_x005F_x000D_Yang J., Everett A.D._x005F_x005F_x000D_BMC Mol. Biol. 8:101-101(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, DNA-BINDING. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

Hdgf ELISA Kit (Mouse) (OKCD01531)
OKCD01531	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Heparin-binding protein, with mitogenic activity for fibroblasts. Acts as a transcriptional repressor.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.4 pg/mL

HDGF ELISA Kit (Human) (OKAN06027)
OKAN06027	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the hepatoma-derived growth factor family. The encoded protein has mitogenic and DNA-binding activity and may play a role in cellular proliferation and differentiation. High levels of expression of this gene enhance the growth of many tumors. This gene was thought initially to be located on chromosome X; however, that location has been determined to correspond to a related pseudogene. Alternatively spliced transcript variants encoding distinct isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

HDGF sgRNA CRISPR Lentivector set (Human)
K0941201	ABM	3 x 1.0 ug	EUR 339

Hdgf sgRNA CRISPR Lentivector set (Mouse)
K4641401	ABM	3 x 1.0 ug	EUR 339

Mouse Hepatoma-derived growth factor (Hdgf)
1-CSB-YP010249MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 30.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Hepatoma-derived growth factor(Hdgf) expressed in Yeast

Hdgf sgRNA CRISPR Lentivector set (Rat)
K6948001	ABM	3 x 1.0 ug	EUR 339

Recombinant Hepatoma Derived Growth Factor (HDGF)
4-RPA624Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51858 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.5kDa Isoelectric Point: 4.9
Description: Recombinant Human Hepatoma Derived Growth Factor expressed in: E.coli

Recombinant Hepatoma Derived Growth Factor (HDGF)
4-RPA624Mu01	Cloud-Clone	EUR 483.49 EUR 232.00 EUR 1538.08 EUR 579.36 EUR 1058.72 EUR 386.00 EUR 3695.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51859 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 20.8kDa Isoelectric Point: 5.4
Description: Recombinant Mouse Hepatoma Derived Growth Factor expressed in: E.coli

Human Hepatoma-Derived Growth Factor (HDGF) Antibody (Biotin Conjugate)
32013-05121	AssayPro	150 ug	EUR 369

Rat Hepatoma Derived Growth Factor (HDGF) Protein
20-abx653734	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

HDGF sgRNA CRISPR Lentivector (Human) (Target 1)
K0941202	ABM	1.0 ug DNA	EUR 154

HDGF sgRNA CRISPR Lentivector (Human) (Target 2)
K0941203	ABM	1.0 ug DNA	EUR 154

HDGF sgRNA CRISPR Lentivector (Human) (Target 3)
K0941204	ABM	1.0 ug DNA	EUR 154

Mouse Hepatoma Derived Growth Factor (HDGF) Protein
20-abx067076	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Hepatoma Derived Growth Factor (HDGF) Protein
20-abx168070	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Hepatoma Derived Growth Factor (HDGF) Protein
20-abx261882	Abbexa	EUR 4490.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4641402	ABM	1.0 ug DNA	EUR 154

Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4641403	ABM	1.0 ug DNA	EUR 154

Hdgf sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4641404	ABM	1.0 ug DNA	EUR 154

Hdgf sgRNA CRISPR Lentivector (Rat) (Target 1)
K6948002	ABM	1.0 ug DNA	EUR 154

Hdgf sgRNA CRISPR Lentivector (Rat) (Target 2)
K6948003	ABM	1.0 ug DNA	EUR 154

Hdgf sgRNA CRISPR Lentivector (Rat) (Target 3)
K6948004	ABM	1.0 ug DNA	EUR 154

Recombinant Human HDGF Protein, Untagged, E.coli-1mg
QP12205-1mg	EnQuireBio	1mg	EUR 3655

Recombinant Human HDGF Protein, Untagged, E.coli-20ug
QP12205-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human HDGF Protein, Untagged, E.coli-5ug
QP12205-5ug	EnQuireBio	5ug	EUR 155

HDGF Protein Vector (Rat) (pPB-C-His)
PV272482	ABM	500 ng	EUR 603

HDGF Protein Vector (Rat) (pPB-N-His)
PV272483	ABM	500 ng	EUR 603

HDGF Protein Vector (Rat) (pPM-C-HA)
PV272484	ABM	500 ng	EUR 603

HDGF Protein Vector (Rat) (pPM-C-His)
PV272485	ABM	500 ng	EUR 603

HDGF Protein Vector (Human) (pPB-C-His)
PV019353	ABM	500 ng	EUR 329

HDGF Protein Vector (Human) (pPB-N-His)
PV019354	ABM	500 ng	EUR 329

HDGF Protein Vector (Human) (pPM-C-HA)
PV019355	ABM	500 ng	EUR 329

HDGF Protein Vector (Human) (pPM-C-His)
PV019356	ABM	500 ng	EUR 329

HDGF Protein Vector (Mouse) (pPB-C-His)
PV188218	ABM	500 ng	EUR 603

HDGF Protein Vector (Mouse) (pPB-N-His)
PV188219	ABM	500 ng	EUR 603

HDGF Protein Vector (Mouse) (pPM-C-HA)
PV188220	ABM	500 ng	EUR 603

HDGF Protein Vector (Mouse) (pPM-C-His)
PV188221	ABM	500 ng	EUR 603

Hdgf 3'UTR Luciferase Stable Cell Line
TU205696	ABM	1.0 ml	Ask for price

Hdgf 3'UTR GFP Stable Cell Line
TU159417	ABM	1.0 ml	Ask for price

HDGF 3'UTR Luciferase Stable Cell Line
TU009672	ABM	1.0 ml	EUR 1394

Hdgf 3'UTR Luciferase Stable Cell Line
TU109417	ABM	1.0 ml	Ask for price

HDGF 3'UTR GFP Stable Cell Line
TU059672	ABM	1.0 ml	EUR 1394

Hdgf 3'UTR GFP Stable Cell Line
TU255696	ABM	1.0 ml	Ask for price

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HDGF Rabbit Polyclonal Antibody