HIPK1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
HIPK1 Polyclonal Antibody |
ABP58782-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
- Applications tips:
|
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950 |
HIPK1 Polyclonal Antibody |
ABP58782-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
- Applications tips:
|
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950 |
HIPK1 Polyclonal Antibody |
ABP58782-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
- Applications tips:
|
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950 |
HIPK1 Polyclonal Antibody |
ES8953-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HIPK1 Polyclonal Antibody |
ES8953-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HIPK1 Polyclonal Antibody |
ES9076-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HIPK1 Polyclonal Antibody |
ES9076-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HIPK1 antibody |
70R-2078 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal HIPK1 antibody raised against the middle region of HIPK1 |
HIPK1 Antibody |
37619-100ul |
SAB |
100ul |
EUR 252 |
HIPK1 Antibody |
1-CSB-PA145013 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
HIPK1 Antibody |
1-CSB-PA803159LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
HIPK1 Antibody |
DF8847 |
Affbiotech |
200ul |
EUR 304 |
Description: HIPK1 Antibody detects endogenous levels of total HIPK1. |
HIPK1 Antibody |
1-CSB-PA035565 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100 |
Polyclonal HIPK1 Antibody (C-term) |
APR16693G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HIPK1 (C-term). This antibody is tested and proven to work in the following applications: |
HIPK1 Polyclonal Antibody, HRP Conjugated |
A69028 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
HIPK1 Polyclonal Antibody, FITC Conjugated |
A69029 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
HIPK1 Polyclonal Antibody, Biotin Conjugated |
A69030 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
HIPK1 Conjugated Antibody |
C37619 |
SAB |
100ul |
EUR 397 |
Anti-HIPK1 antibody |
STJ190111 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to HIPK1 |
Anti-HIPK1 antibody |
STJ190234 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to HIPK1 |
HIPK1 siRNA |
20-abx919387 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HIPK1 siRNA |
20-abx919388 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-HIPK1 |
YF-PA26972 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to HIPK1 |
HIPK1 Antibody, HRP conjugated |
1-CSB-PA803159LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
HIPK1 Antibody, FITC conjugated |
1-CSB-PA803159LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
HIPK1 Antibody, Biotin conjugated |
1-CSB-PA803159LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
HIPK1/2/3 Antibody |
DF10333 |
Affbiotech |
200ul |
EUR 304 |
Description: HIPK1/2/3 Antibody detects endogenous levels of HIPK1/2/3. |
HIPK1 Blocking Peptide |
33R-7200 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HIPK1 antibody, catalog no. 70R-2078 |
HIPK1 Blocking Peptide |
DF8847-BP |
Affbiotech |
1mg |
EUR 195 |
HIPK1 cloning plasmid |
CSB-CL803159HU-10ug |
Cusabio |
10ug |
EUR 796 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2451
- Sequence: atggttttgatgtttcagattcgttatatttcacaaacacaaggcttgccagctgaatatcttctcagtgccggaacaaaaacaaccaggtttttcaacagagatcctaatttggggtacccactgtggaggcttaagacacctgaagaacatgaactggagactggaataaaat
- Show more
|
Description: A cloning plasmid for the HIPK1 gene. |
Anti-HIPK1 (4C2) |
YF-MA11764 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Anti-HIPK1 (1D6) |
YF-MA11765 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Anti-HIPK1 (1F2) |
YF-MA20025 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Anti-HIPK1 (4D5) |
YF-MA20026 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Anti-HIPK1 (4E1) |
YF-MA20027 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human) |
4-PAC526Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1) |
Human HIPK1 shRNA Plasmid |
20-abx966354 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse HIPK1 shRNA Plasmid |
20-abx970805 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HIPK1/2/3 (Phospho-Tyr352/361/359) Polyclonal Conjugated Antibody |
C12507 |
SAB |
100ul |
EUR 397 |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), APC |
4-PAC526Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with APC. |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), Biotinylated |
4-PAC526Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with Biotin. |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), Cy3 |
4-PAC526Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with Cy3. |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), FITC |
4-PAC526Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with FITC. |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), HRP |
4-PAC526Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with HRP. |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), PE |
4-PAC526Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with PE. |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC526Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with APC-Cy7. |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody |
abx026832-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody |
abx026832-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody |
20-abx213865 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody |
20-abx213933 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HIPK1 / 2 / 3 (pY352 / 361 / 359) Antibody |
abx215887-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody |
20-abx131354 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody |
abx145234-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Monoclonal HIPK1 Antibody (clone 1D6), Clone: 1D6 |
APR16694G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human HIPK1 (clone 1D6). The antibodies are raised in Mouse and are from clone 1D6. This antibody is applicable in IHC-P, E |
Monoclonal HIPK1 Antibody (monoclonal) (M04), Clone: 1F2 |
APR16695G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human HIPK1 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 1F2. This antibody is applicable in WB and IF |
Monoclonal HIPK1 Antibody (monoclonal) (M07), Clone: 40 |
APR16696G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A Monoclonal antibody against Human HIPK1 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 40. This antibody is applicable in WB and IF, E |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody |
20-abx334178 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
HIPK1/2/3 Blocking Peptide |
DF10333-BP |
Affbiotech |
1mg |
EUR 195 |
Hipk1 ORF Vector (Rat) (pORF) |
ORF068198 |
ABM |
1.0 ug DNA |
EUR 506 |
HIPK1 ORF Vector (Human) (pORF) |
ORF004894 |
ABM |
1.0 ug DNA |
EUR 95 |
Hipk1 ORF Vector (Mouse) (pORF) |
ORF047171 |
ABM |
1.0 ug DNA |
EUR 506 |
HIPK1/2/3 (Phospho-Tyr352/361/359) Antibody |
12507-100ul |
SAB |
100ul |
EUR 252 |
HIPK1/2/3 (Phospho-Tyr352/361/359) Antibody |
12507-50ul |
SAB |
50ul |
EUR 187 |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody (HRP) |
20-abx336060 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody (FITC) |
20-abx336061 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Homeodomain Interacting Protein Kinase 1 (HIPK1) Antibody (Biotin) |
20-abx336062 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Phospho-HIPK1/2/3 (Tyr352/361/359) Antibody |
AF8155 |
Affbiotech |
200ul |
EUR 376 |
Description: HIPK1/2/3 (Phospho-Tyr352/361/359) Antibody detects endogenous levels of HIPK1/2/3 only when phosphorylated at Tyr352/361/359. |
Hipk1 sgRNA CRISPR Lentivector set (Mouse) |
K4642801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hipk1 sgRNA CRISPR Lentivector set (Rat) |
K6259901 |
ABM |
3 x 1.0 ug |
EUR 339 |
HIPK1 sgRNA CRISPR Lentivector set (Human) |
K0952701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Hipk1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4642802 |
ABM |
1.0 ug DNA |
EUR 154 |
Hipk1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4642803 |
ABM |
1.0 ug DNA |
EUR 154 |
Hipk1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4642804 |
ABM |
1.0 ug DNA |
EUR 154 |
Hipk1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6259902 |
ABM |
1.0 ug DNA |
EUR 154 |
Hipk1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6259903 |
ABM |
1.0 ug DNA |
EUR 154 |
Hipk1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6259904 |
ABM |
1.0 ug DNA |
EUR 154 |
HIPK1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0952702 |
ABM |
1.0 ug DNA |
EUR 154 |
HIPK1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K0952703 |
ABM |
1.0 ug DNA |
EUR 154 |
HIPK1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K0952704 |
ABM |
1.0 ug DNA |
EUR 154 |
HIPK1 Protein Vector (Rat) (pPB-C-His) |
PV272790 |
ABM |
500 ng |
EUR 1191 |
HIPK1 Protein Vector (Rat) (pPB-N-His) |
PV272791 |
ABM |
500 ng |
EUR 1191 |
HIPK1 Protein Vector (Rat) (pPM-C-HA) |
PV272792 |
ABM |
500 ng |
EUR 1191 |
HIPK1 Protein Vector (Rat) (pPM-C-His) |
PV272793 |
ABM |
500 ng |
EUR 1191 |
HIPK1 Protein Vector (Mouse) (pPB-C-His) |
PV188682 |
ABM |
500 ng |
EUR 1065 |
HIPK1 Protein Vector (Mouse) (pPB-N-His) |
PV188683 |
ABM |
500 ng |
EUR 1065 |
HIPK1 Protein Vector (Mouse) (pPM-C-HA) |
PV188684 |
ABM |
500 ng |
EUR 1065 |
HIPK1 Protein Vector (Mouse) (pPM-C-His) |
PV188685 |
ABM |
500 ng |
EUR 1065 |
HIPK1 Protein Vector (Human) (pPB-C-His) |
PV019573 |
ABM |
500 ng |
EUR 329 |
HIPK1 Protein Vector (Human) (pPB-N-His) |
PV019574 |
ABM |
500 ng |
EUR 329 |
HIPK1 Protein Vector (Human) (pPM-C-HA) |
PV019575 |
ABM |
500 ng |
EUR 329 |
HIPK1 Protein Vector (Human) (pPM-C-His) |
PV019576 |
ABM |
500 ng |
EUR 329 |
Recombinant Homeodomain Interacting Protein Kinase 1 (HIPK1) |
4-RPC526Hu01 |
Cloud-Clone |
-
EUR 476.32
-
EUR 230.00
-
EUR 1511.20
-
EUR 570.40
-
EUR 1040.80
-
EUR 382.00
-
EUR 3628.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q86Z02
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 35.6kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Homeodomain Interacting Protein Kinase 1 expressed in: E.coli |
Hipk1 3'UTR Luciferase Stable Cell Line |
TU109514 |
ABM |
1.0 ml |
Ask for price |
Hipk1 3'UTR Luciferase Stable Cell Line |
TU205779 |
ABM |
1.0 ml |
Ask for price |
Hipk1 3'UTR GFP Stable Cell Line |
TU159514 |
ABM |
1.0 ml |
Ask for price |
Hipk1 3'UTR GFP Stable Cell Line |
TU255779 |
ABM |
1.0 ml |
Ask for price |
HIPK1 3'UTR GFP Stable Cell Line |
TU059792 |
ABM |
1.0 ml |
EUR 4617 |
HIPK1 3'UTR Luciferase Stable Cell Line |
TU009792 |
ABM |
1.0 ml |
EUR 4617 |
Human Homeodomain Interacting Protein Kinase 1 (HIPK1) Protein |
20-abx650018 |
Abbexa |
-
EUR 662.00
-
EUR 272.00
-
EUR 2040.00
-
EUR 787.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
HIPK1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV665323 |
ABM |
1.0 ug DNA |
EUR 1355 |
HIPK1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV665327 |
ABM |
1.0 ug DNA |
EUR 1355 |
HIPK1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV665328 |
ABM |
1.0 ug DNA |
EUR 1355 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
HIPK1 Rabbit Polyclonal Antibody