HIPK1 Rabbit Polyclonal Antibody

HIPK1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

HIPK1 Polyclonal Antibody
ES9076-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 Polyclonal Antibody
ES9076-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HIPK1 Polyclonal Antibody
ABP58781-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370

HIPK1 Polyclonal Antibody
ABP58781-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370

HIPK1 Polyclonal Antibody
ABP58781-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370

HIPK1 Polyclonal Antibody
ABP58782-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950

HIPK1 Polyclonal Antibody
ABP58782-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950

HIPK1 Polyclonal Antibody
ABP58782-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
  • Applications tips:
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950

HIPK1 Polyclonal Antibody
A69027 100 ?g
EUR 628.55
Description: kits suitable for this type of research

HIPK1 Antibody
ABD8847 100 ug
EUR 438

HIPK1 antibody
70R-2078 50 ug
EUR 467
Description: Rabbit polyclonal HIPK1 antibody raised against the middle region of HIPK1

HIPK1 Antibody
37619-100ul 100ul
EUR 252

HIPK1 Antibody
DF8847 200ul
EUR 304
Description: HIPK1 Antibody detects endogenous levels of total HIPK1.

HIPK1 Antibody
1-CSB-PA803159LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

HIPK1 Antibody
1-CSB-PA145013
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

HIPK1 Antibody
1-CSB-PA035565
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100

Polyclonal HIPK1 Antibody (C-term)
APR16693G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HIPK1 (C-term). This antibody is tested and proven to work in the following applications:

HIPK1 Polyclonal Antibody, HRP Conjugated
A69028 100 ?g
EUR 628.55
Description: fast delivery possible

HIPK1 Polyclonal Antibody, FITC Conjugated
A69029 100 ?g
EUR 628.55
Description: reagents widely cited

HIPK1 Polyclonal Antibody, Biotin Conjugated
A69030 100 ?g
EUR 628.55
Description: Ask the seller for details

HIPK1 Conjugated Antibody
C37619 100ul
EUR 397

Anti-HIPK1 Antibody
STJ501340 100 µg
EUR 476

Anti-HIPK1 antibody
STJ190111 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HIPK1

Anti-HIPK1 antibody
STJ190234 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to HIPK1

Hipk1/ Rat Hipk1 ELISA Kit
ELI-38786r 96 Tests
EUR 886

HIPK1 siRNA
20-abx919387
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HIPK1 siRNA
20-abx919388
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-HIPK1
YF-PA26972 50 ul
EUR 334
Description: Mouse polyclonal to HIPK1

HIPK1/2/3 Antibody
DF10333 200ul
EUR 304
Description: HIPK1/2/3 Antibody detects endogenous levels of HIPK1/2/3.

HIPK1 Antibody, HRP conjugated
1-CSB-PA803159LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HIPK1 Antibody, FITC conjugated
1-CSB-PA803159LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HIPK1 Antibody, Biotin conjugated
1-CSB-PA803159LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-HIPK1 Antibody (Biotin)
STJ501341 100 µg
EUR 586

Anti-HIPK1 Antibody (FITC)
STJ501342 100 µg
EUR 586

HIPK1 Blocking Peptide
33R-7200 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HIPK1 antibody, catalog no. 70R-2078

HIPK1 Blocking Peptide
DF8847-BP 1mg
EUR 195

HIPK1 cloning plasmid
CSB-CL803159HU-10ug 10ug
EUR 796
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2451
  • Sequence: atggttttgatgtttcagattcgttatatttcacaaacacaaggcttgccagctgaatatcttctcagtgccggaacaaaaacaaccaggtttttcaacagagatcctaatttggggtacccactgtggaggcttaagacacctgaagaacatgaactggagactggaataaaat
  • Show more
Description: A cloning plasmid for the HIPK1 gene.

Anti-HIPK1 (4C2)
YF-MA11764 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Anti-HIPK1 (1D6)
YF-MA11765 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Anti-HIPK1 (1F2)
YF-MA20025 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Anti-HIPK1 (4D5)
YF-MA20026 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Anti-HIPK1 (4E1)
YF-MA20027 100 ug
EUR 363
Description: Mouse monoclonal to HIPK1

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human)
4-PAC526Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1)

Human HIPK1 shRNA Plasmid
20-abx966354
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse HIPK1 shRNA Plasmid
20-abx970805
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HIPK1/2/3 (Phospho-Tyr352/361/359) Polyclonal Conjugated Antibody
C12507 100ul
EUR 397

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), APC
4-PAC526Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with APC.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), Biotinylated
4-PAC526Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with Biotin.

Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), Cy3
4-PAC526Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: HIPK1 (Met1~Lys290)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with Cy3.

HIPK1 Rabbit Polyclonal Antibody

Back To Top