HIPK1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
HIPK1 Polyclonal Antibody |
ES9076-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HIPK1 Polyclonal Antibody |
ES9076-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HIPK1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
HIPK1 Polyclonal Antibody |
ABP58781-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370 |
HIPK1 Polyclonal Antibody |
ABP58781-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370 |
HIPK1 Polyclonal Antibody |
ABP58781-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370
- Applications tips:
|
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 290-370 |
HIPK1 Polyclonal Antibody |
ABP58782-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
- Applications tips:
|
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950 |
HIPK1 Polyclonal Antibody |
ABP58782-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
- Applications tips:
|
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950 |
HIPK1 Polyclonal Antibody |
ABP58782-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950
- Applications tips:
|
Description: A polyclonal antibody for detection of HIPK1 from Human, Mouse, Rat. This HIPK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human HIPK1 protein at amino acid sequence of 870-950 |
HIPK1 Polyclonal Antibody |
A69027 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: kits suitable for this type of research |
HIPK1 antibody |
70R-2078 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal HIPK1 antibody raised against the middle region of HIPK1 |
HIPK1 Antibody |
37619-100ul |
SAB |
100ul |
EUR 252 |
HIPK1 Antibody |
DF8847 |
Affbiotech |
200ul |
EUR 304 |
Description: HIPK1 Antibody detects endogenous levels of total HIPK1. |
HIPK1 Antibody |
1-CSB-PA803159LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200 |
HIPK1 Antibody |
1-CSB-PA145013 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100 |
HIPK1 Antibody |
1-CSB-PA035565 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:50-1:100 |
Polyclonal HIPK1 Antibody (C-term) |
APR16693G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HIPK1 (C-term). This antibody is tested and proven to work in the following applications: |
HIPK1 Polyclonal Antibody, HRP Conjugated |
A69028 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: fast delivery possible |
HIPK1 Polyclonal Antibody, FITC Conjugated |
A69029 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: reagents widely cited |
HIPK1 Polyclonal Antibody, Biotin Conjugated |
A69030 |
EpiGentek |
100 ?g |
EUR 628.55 |
Description: Ask the seller for details |
HIPK1 Conjugated Antibody |
C37619 |
SAB |
100ul |
EUR 397 |
Anti-HIPK1 antibody |
STJ190111 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to HIPK1 |
Anti-HIPK1 antibody |
STJ190234 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to HIPK1 |
HIPK1 siRNA |
20-abx919387 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
HIPK1 siRNA |
20-abx919388 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-HIPK1 |
YF-PA26972 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to HIPK1 |
HIPK1/2/3 Antibody |
DF10333 |
Affbiotech |
200ul |
EUR 304 |
Description: HIPK1/2/3 Antibody detects endogenous levels of HIPK1/2/3. |
HIPK1 Antibody, HRP conjugated |
1-CSB-PA803159LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
HIPK1 Antibody, FITC conjugated |
1-CSB-PA803159LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
HIPK1 Antibody, Biotin conjugated |
1-CSB-PA803159LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against HIPK1. Recognizes HIPK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
HIPK1 Blocking Peptide |
33R-7200 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HIPK1 antibody, catalog no. 70R-2078 |
HIPK1 Blocking Peptide |
DF8847-BP |
Affbiotech |
1mg |
EUR 195 |
HIPK1 cloning plasmid |
CSB-CL803159HU-10ug |
Cusabio |
10ug |
EUR 796 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2451
- Sequence: atggttttgatgtttcagattcgttatatttcacaaacacaaggcttgccagctgaatatcttctcagtgccggaacaaaaacaaccaggtttttcaacagagatcctaatttggggtacccactgtggaggcttaagacacctgaagaacatgaactggagactggaataaaat
- Show more
|
Description: A cloning plasmid for the HIPK1 gene. |
Anti-HIPK1 (4C2) |
YF-MA11764 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Anti-HIPK1 (1D6) |
YF-MA11765 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Anti-HIPK1 (1F2) |
YF-MA20025 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Anti-HIPK1 (4D5) |
YF-MA20026 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Anti-HIPK1 (4E1) |
YF-MA20027 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to HIPK1 |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human) |
4-PAC526Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1) |
Human HIPK1 shRNA Plasmid |
20-abx966354 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse HIPK1 shRNA Plasmid |
20-abx970805 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
HIPK1/2/3 (Phospho-Tyr352/361/359) Polyclonal Conjugated Antibody |
C12507 |
SAB |
100ul |
EUR 397 |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), APC |
4-PAC526Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with APC. |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), Biotinylated |
4-PAC526Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with Biotin. |
Homeodomain Interacting Protein Kinase 1 (HIPK1) Polyclonal Antibody (Human), Cy3 |
4-PAC526Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: HIPK1 (Met1~Lys290)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Homeodomain Interacting Protein Kinase 1 (HIPK1). This antibody is labeled with Cy3. |
HIPK1 Rabbit Polyclonal Antibody