INSL3 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
INSL3 Polyclonal Antibody |
ABP58945-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human INSL3 protein at amino acid sequence of 10-50
- Applications tips:
|
Description: A polyclonal antibody for detection of INSL3 from Human. This INSL3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human INSL3 protein at amino acid sequence of 10-50 |
INSL3 Polyclonal Antibody |
ABP58945-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human INSL3 protein at amino acid sequence of 10-50
- Applications tips:
|
Description: A polyclonal antibody for detection of INSL3 from Human. This INSL3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human INSL3 protein at amino acid sequence of 10-50 |
INSL3 Polyclonal Antibody |
ABP58945-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human INSL3 protein at amino acid sequence of 10-50
- Applications tips:
|
Description: A polyclonal antibody for detection of INSL3 from Human. This INSL3 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human INSL3 protein at amino acid sequence of 10-50 |
INSL3 Polyclonal Antibody |
46793-100ul |
SAB |
100ul |
EUR 252 |
INSL3 Polyclonal Antibody |
46793-50ul |
SAB |
50ul |
EUR 187 |
INSL3 Rabbit pAb |
A5728-100ul |
Abclonal |
100 ul |
EUR 308 |
INSL3 Rabbit pAb |
A5728-200ul |
Abclonal |
200 ul |
EUR 459 |
INSL3 Rabbit pAb |
A5728-20ul |
Abclonal |
20 ul |
EUR 183 |
INSL3 Rabbit pAb |
A5728-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Insulin Like Protein 3 (INSL3) ELISA Kit |
DLR-INSL3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Insulin Like Protein 3 (INSL3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Protein 3 (INSL3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Insulin Like Protein 3 (INSL3) ELISA Kit |
DLR-INSL3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Insulin Like Protein 3 (INSL3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Insulin Like Protein 3 (INSL3) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Insulin Like Protein 3 (INSL3) ELISA Kit |
DLR-INSL3-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Insulin Like Protein 3 (INSL3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Protein 3 (INSL3) in samples from serum, plasma or other biological fluids. |
Mouse Insulin Like Protein 3 (INSL3) ELISA Kit |
DLR-INSL3-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Insulin Like Protein 3 (INSL3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Insulin Like Protein 3 (INSL3) in samples from serum, plasma or other biological fluids. |
Rat Insulin Like Protein 3 (INSL3) ELISA Kit |
DLR-INSL3-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Insulin Like Protein 3 (INSL3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Insulin Like Protein 3 (INSL3) in samples from serum, plasma or other biological fluids. |
Rat Insulin Like Protein 3 (INSL3) ELISA Kit |
DLR-INSL3-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Insulin Like Protein 3 (INSL3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Insulin Like Protein 3 (INSL3) in samples from serum, plasma or other biological fluids. |
Human Insulin Like Protein 3 (INSL3) ELISA Kit |
RD-INSL3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Insulin Like Protein 3 (INSL3) ELISA Kit |
RD-INSL3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Insulin Like Protein 3 (INSL3) ELISA Kit |
RD-INSL3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Insulin Like Protein 3 (INSL3) ELISA Kit |
RD-INSL3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Insulin Like Protein 3 (INSL3) ELISA Kit |
RD-INSL3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Insulin Like Protein 3 (INSL3) ELISA Kit |
RD-INSL3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Human Insulin Like Protein 3 (INSL3) ELISA Kit |
RDR-INSL3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Insulin Like Protein 3 (INSL3) ELISA Kit |
RDR-INSL3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Insulin Like Protein 3 (INSL3) ELISA Kit |
RDR-INSL3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Insulin Like Protein 3 (INSL3) ELISA Kit |
RDR-INSL3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Insulin Like Protein 3 (INSL3) ELISA Kit |
RDR-INSL3-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Insulin Like Protein 3 (INSL3) ELISA Kit |
RDR-INSL3-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Polyclonal INSL3 Antibody (aa19-68) |
APR16866G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human INSL3 (aa19-68). This antibody is tested and proven to work in the following applications: |
INSL3 Antibody |
AF5227 |
Affbiotech |
200ul |
EUR 304 |
Description: INSL3 Antibody detects endogenous levels of total INSL3. |
INSL3 Antibody |
32997-100ul |
SAB |
100ul |
EUR 252 |
INSL3 antibody |
70R-13727 |
Fitzgerald |
100 ug |
EUR 322 |
Description: Affinity purified Rabbit polyclonal INSL3 antibody |
INSL3 Antibody |
1-CSB-PA489038 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against INSL3. Recognizes INSL3 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000 |
INSL3 Conjugated Antibody |
C32997 |
SAB |
100ul |
EUR 397 |
anti- INSL3 antibody |
FNab04335 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:500 - 1:2000
- IHC: 1:50 - 1:100
- Immunogen: insulin-like 3 (Leydig cell)
- Uniprot ID: P51460
- Gene ID: 3640
- Research Area: Signal Transduction, Developmental biology
|
Description: Antibody raised against INSL3 |
Anti-INSL3 Antibody |
PA1044 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-INSL3 antibody |
STJ98717 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to INSL3. |
Anti-INSL3 antibody |
STJ28295 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the insulin-like hormone superfamily. The encoded protein is mainly produced in gonadal tissues. Studies of the mouse counterpart suggest that this gene may be involved in the development of urogenital tract and female fertility. This protein may also act as a hormone to regulate growth and differentiation of gubernaculum, and thus mediating intra-abdominal testicular descent. Mutations in this gene may lead to cryptorchidism. Alternate splicing results in multiple transcript variants. |
INSL3 siRNA |
20-abx920669 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
INSL3 siRNA |
20-abx920670 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Human) |
4-PAD873Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Asp2~Cys129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Insulin Like Protein 3 (INSL3) |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Rat) |
4-PAD873Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Gln63~His129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Insulin Like Protein 3 (INSL3) |
INSL3 Blocking Peptide |
AF5227-BP |
Affbiotech |
1mg |
EUR 195 |
INSL3 cloning plasmid |
CSB-CL011747HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 396
- Sequence: ATGGACCCCCGTCTGCCCGCCTGGGCGCTGGTGCTGCTGGGCCCTGCCCTGGTGTTCGCGTTGGGCCCCGCGCCCACCCCAGAGATGCGTGAGAAGTTGTGCGGCCACCACTTCGTACGCGCGCTAGTGCGCGTGTGCGGGGGCCCCCGCTGGTCCACCGAAGCCAGGAGGCCTGC
- Show more
|
Description: A cloning plasmid for the INSL3 gene. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Human), APC |
4-PAD873Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Asp2~Cys129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Insulin Like Protein 3 (INSL3). This antibody is labeled with APC. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Human), Biotinylated |
4-PAD873Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Asp2~Cys129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Insulin Like Protein 3 (INSL3). This antibody is labeled with Biotin. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Human), Cy3 |
4-PAD873Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Asp2~Cys129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Insulin Like Protein 3 (INSL3). This antibody is labeled with Cy3. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Human), FITC |
4-PAD873Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Asp2~Cys129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Insulin Like Protein 3 (INSL3). This antibody is labeled with FITC. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Human), HRP |
4-PAD873Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Asp2~Cys129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Insulin Like Protein 3 (INSL3). This antibody is labeled with HRP. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Human), PE |
4-PAD873Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Asp2~Cys129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Insulin Like Protein 3 (INSL3). This antibody is labeled with PE. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Rat), APC |
4-PAD873Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Gln63~His129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Insulin Like Protein 3 (INSL3). This antibody is labeled with APC. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Rat), Biotinylated |
4-PAD873Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Gln63~His129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Insulin Like Protein 3 (INSL3). This antibody is labeled with Biotin. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Rat), Cy3 |
4-PAD873Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Gln63~His129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Insulin Like Protein 3 (INSL3). This antibody is labeled with Cy3. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Rat), FITC |
4-PAD873Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Gln63~His129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Insulin Like Protein 3 (INSL3). This antibody is labeled with FITC. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Rat), HRP |
4-PAD873Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Gln63~His129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Insulin Like Protein 3 (INSL3). This antibody is labeled with HRP. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Rat), PE |
4-PAD873Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Gln63~His129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Insulin Like Protein 3 (INSL3). This antibody is labeled with PE. |
Rabbit Insulin Like Protein 3 (INSL3) ELISA Kit |
abx363760-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Insulin like protein 3(INSL3) ELISA kit |
E04I0437-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Insulin like protein 3(INSL3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Insulin like protein 3(INSL3) ELISA kit |
E04I0437-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Insulin like protein 3(INSL3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Insulin like protein 3(INSL3) ELISA kit |
E04I0437-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Insulin like protein 3(INSL3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Insulin Like Protein 3 (INSL3) ELISA kit |
E04I0467-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Insulin Like Protein 3 (INSL3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Insulin Like Protein 3 (INSL3) ELISA kit |
E04I0467-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Insulin Like Protein 3 (INSL3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Insulin Like Protein 3 (INSL3) ELISA kit |
E04I0467-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Insulin Like Protein 3 (INSL3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD873Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Asp2~Cys129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Insulin Like Protein 3 (INSL3). This antibody is labeled with APC-Cy7. |
Insulin Like Protein 3 (INSL3) Polyclonal Antibody (Rat), APC-Cy7 |
4-PAD873Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: INSL3 (Gln63~His129)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Rat Insulin Like Protein 3 (INSL3). This antibody is labeled with APC-Cy7. |
Insulin Like Protein 3 (INSL3) Antibody |
20-abx128999 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Insulin Like Protein 3 (INSL3) Antibody |
20-abx130222 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Insulin Like Protein 3 (INSL3) Antibody |
abx037125-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Insulin Like Protein 3 (INSL3) Antibody |
20-abx004380 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Insulin Like Protein 3 (INSL3) Antibody |
20-abx172944 |
Abbexa |
|
|
|
Insulin Like Protein 3 (INSL3) Antibody |
20-abx172945 |
Abbexa |
|
|
|
Insulin Like Protein 3 (INSL3) Antibody |
20-abx176995 |
Abbexa |
|
|
|
Insulin Like Protein 3 (INSL3) Antibody |
20-abx176996 |
Abbexa |
|
|
|
Insulin Like Protein 3 (INSL3) Antibody |
20-abx323194 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Insulin Like Protein 3 (INSL3) Antibody |
abx234335-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Rat INSL3 shRNA Plasmid |
20-abx987182 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human INSL3 shRNA Plasmid |
20-abx952440 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Insl3 ORF Vector (Rat) (pORF) |
ORF068704 |
ABM |
1.0 ug DNA |
EUR 506 |
Insl3 ORF Vector (Mouse) (pORF) |
ORF047984 |
ABM |
1.0 ug DNA |
EUR 506 |
INSL3 ORF Vector (Human) (pORF) |
ORF013371 |
ABM |
1.0 ug DNA |
EUR 354 |
INSL3 ELISA Kit (Human) (OKAN05536) |
OKAN05536 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the insulin-like hormone superfamily. The encoded protein is mainly produced in gonadal tissues. Studies of the mouse counterpart suggest that this gene may be involved in the development of urogenital tract and female fertility. This protein may also act as a hormone to regulate growth and differentiation of gubernaculum, and thus mediating intra-abdominal testicular descent. Mutations in this gene may lead to cryptorchidism. Alternate splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL |
INSL3 ELISA Kit (Mouse) (OKCD02647) |
OKCD02647 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Seems to play a role in testicular function. May be a trophic hormone with a role in testicular descent in fetal life. Is a ligand for LGR8 receptor.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.4 pg/mL |
INSL3 ELISA Kit (Human) (OKCD08554) |
OKCD08554 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Insulin-like 3 (INSL3), a member of the insulin-like hormone superfamily, is specifically expressed in Leydig cells of the fetal and postnatal testis and in theca cells of the postnatal ovary. It is synthesized as a 131-amino acid preproprotein, which contains a 24-amino acid signal peptide. The human INSL3 gene is assigned to bands p13.2-p12 of the short arm of chromosome 19 with the similar organization to that of insulin and relaxin. INSL3 induces gubernaculum development in an androgen-independent way, while androgen-mediated regression of the CSL occurs independently from Insl3. Moreover, INSL3 is a ligand for LGR8 and INSL3-LGR8 mutations are believed to be associated with human cryptorchidism.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.8pg/mL |
INSL3 ELISA Kit (Rat) (OKEH03057) |
OKEH03057 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Seems to play a role in testicular function. May be a trophic hormone with a role in testicular descent in fetal life. Is a ligand for LGR8 receptor.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL |
INSL3 ELISA Kit (Bovine) (OKEH07343) |
OKEH07343 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 24pg/mL |
INSL3 ELISA Kit (Dog) (OKEH07344) |
OKEH07344 |
Aviva Systems Biology |
96 Wells |
EUR 1184 |
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6pg/mL |
Insl3 sgRNA CRISPR Lentivector set (Mouse) |
K3842601 |
ABM |
3 x 1.0 ug |
EUR 339 |
Human INSL3 C-Peptide ELISA Kit |
DEIA-PP7 |
Creative Diagnostics |
96T |
EUR 1053 |
Description: This kit is designed to measure the concentration of a specific peptide and its related peptides based on the principle of a "competitive" enzyme immunoassay. |
INSL3 sgRNA CRISPR Lentivector set (Human) |
K1091101 |
ABM |
3 x 1.0 ug |
EUR 339 |
INSL3 Rabbit Polyclonal Antibody