IRF5 Rabbit Polyclonal Antibody

IRF5 Rabbit Polyclonal Antibody

To Order:

IRF5 Polyclonal Antibody
ABP58963-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of IRF5 from Human, Mouse. This IRF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
IRF5 Polyclonal Antibody
ABP58963-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of IRF5 from Human, Mouse. This IRF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
IRF5 Polyclonal Antibody
ABP58963-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
  • Applications tips:
Description: A polyclonal antibody for detection of IRF5 from Human, Mouse. This IRF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
IRF5 Polyclonal Antibody
ES8994-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IRF5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
IRF5 Polyclonal Antibody
ES8994-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IRF5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
IRF5 Rabbit mAb
A11106-100ul 100 ul
EUR 410
IRF5 Rabbit mAb
A11106-200ul 200 ul
EUR 571
IRF5 Rabbit mAb
A11106-20ul 20 ul
EUR 221
IRF5 Rabbit mAb
A11106-50ul 50 ul
EUR 287
IRF5 Rabbit pAb
A1149-100ul 100 ul
EUR 308
IRF5 Rabbit pAb
A1149-200ul 200 ul
EUR 459
IRF5 Rabbit pAb
A1149-20ul 20 ul
EUR 183
IRF5 Rabbit pAb
A1149-50ul 50 ul
EUR 223
IRF5 Rabbit pAb
A13621-100ul 100 ul
EUR 308
IRF5 Rabbit pAb
A13621-200ul 200 ul
EUR 459
IRF5 Rabbit pAb
A13621-20ul 20 ul
EUR 183
IRF5 Rabbit pAb
A13621-50ul 50 ul
EUR 223
IRF5 Rabbit pAb
A16388-100ul 100 ul
EUR 308
IRF5 Rabbit pAb
A16388-200ul 200 ul
EUR 459
IRF5 Rabbit pAb
A16388-20ul 20 ul
EUR 183
IRF5 Rabbit pAb
A16388-50ul 50 ul
EUR 223
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit
DLR-IRF5-Hu-48T 48T
EUR 444
  • Should the Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit
DLR-IRF5-Hu-96T 96T
EUR 573
  • Should the Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit
DLR-IRF5-Mu-48T 48T
EUR 454
  • Should the Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids.
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit
DLR-IRF5-Mu-96T 96T
EUR 587
  • Should the Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit
RDR-IRF5-Hu-48Tests 48 Tests
EUR 458
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit
RDR-IRF5-Hu-96Tests 96 Tests
EUR 633
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit
RDR-IRF5-Mu-48Tests 48 Tests
EUR 470
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit
RDR-IRF5-Mu-96Tests 96 Tests
EUR 651
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit
RD-IRF5-Hu-48Tests 48 Tests
EUR 439
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit
RD-IRF5-Hu-96Tests 96 Tests
EUR 606
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit
RD-IRF5-Mu-48Tests 48 Tests
EUR 450
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit
RD-IRF5-Mu-96Tests 96 Tests
EUR 622
Anti-IRF5 Rabbit Monoclonal Antibody
M00958 100ug/vial
EUR 397
Description: Rabbit Monoclonal IRF5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-IRF5 Rabbit Monoclonal Antibody
M00958-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal IRF5 Antibody. Validated in WB and tested in Human.
Polyclonal Goat Anti-IRF5 Antibody
APG00173G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IRF5 . This antibody is tested and proven to work in the following applications:
Irf5 Polyclonal Antibody, HRP Conjugated
A62795 100 µg
EUR 570.55
Description: reagents widely cited
Irf5 Polyclonal Antibody, FITC Conjugated
A62796 100 µg
EUR 570.55
Description: Ask the seller for details
Irf5 Polyclonal Antibody, Biotin Conjugated
A62797 100 µg
EUR 570.55
Description: The best epigenetics products
IRF5 antibody
70R-18009 50 ul
EUR 435
Description: Rabbit polyclonal IRF5 antibody
IRF5 Antibody
32184-100ul 100ul
EUR 252
IRF5 antibody
10R-1026 100 ul
EUR 316
Description: Mouse monoclonal IRF5 antibody
IRF5 Antibody
49111-100ul 100ul
EUR 333
IRF5 Antibody
49111-50ul 50ul
EUR 239
IRF5 Antibody
49123-100ul 100ul
EUR 333
IRF5 Antibody
49123-50ul 50ul
EUR 239
IRF5 Antibody
DF6283 200ul
EUR 304
Description: IRF5 Antibody detects endogenous levels of total IRF5.
IRF5 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
IRF5 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
Irf5 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA
IRF5 Antibody
ABD6283 100 ug
EUR 438
Polyclonal IRF5 antibody - N-terminal region
APR00727G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF5 - N-terminal region. This antibody is tested and proven to work in the following applications:
IRF5 (Phospho-Ser437) Polyclonal Conjugated Antibody
C12688 100ul
EUR 397
IRF5 (pS437) Antibody
abx216307-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.
IRF5 Conjugated Antibody
C49111 100ul
EUR 397
IRF5 Conjugated Antibody
C32184 100ul
EUR 397
anti- IRF5 antibody
FNab04391 100µg
EUR 505.25
  • Immunogen: interferon regulatory factor 5
  • Uniprot ID: Q13568
  • Gene ID: 3663
  • Research Area: Epigenetics, Cancer, Immunology, Metabolism
Description: Antibody raised against IRF5
anti- IRF5 antibody
FNab04392 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:3000
  • Immunogen: interferon regulatory factor 5
  • Uniprot ID: Q13568
  • Gene ID: 3663
  • Research Area: Epigenetics, Cancer, Immunology, Metabolism
Description: Antibody raised against IRF5
Anti-IRF5 Antibody
PA2208 100ug/vial
EUR 294
Anti-IRF5 antibody
PAab04391 100 ug
EUR 355
Anti-IRF5 antibody
STJ24230 100 µl
EUR 277
Description: This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment.
Anti-IRF5 antibody
STJ115580 100 µl
EUR 277
Description: This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment.
Anti-IRF5 Antibody
PB9646 100ug/vial
EUR 334
Anti-IRF5 antibody
STJ118828 100 µl
EUR 277
Anti-IRF5 antibody
STJ190152 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to IRF5
Anti-IRF5 antibody
STJ70233 100 µg
EUR 359
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA12773 50 ul
EUR 363
Description: Mouse polyclonal to IRF5
YF-PA12774 100 ug
EUR 403
Description: Rabbit polyclonal to IRF5
Rabbit Anti-IRF5 monoclonal antibody, clone TE314-18
CABT-L772 100 ul
EUR 777
IRF5 (Phospho-Ser437) Antibody
12688-100ul 100ul
EUR 252
IRF5 (Phospho-Ser437) Antibody
12688-50ul 50ul
EUR 187
IRF5 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
Irf5 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA
IRF5 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
Irf5 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA
IRF5 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Irf5 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA
Phospho-IRF5 (Ser437) Antibody
AF8382 200ul
EUR 376
Description: IRF5 (Phospho-Ser437) Antibody detects endogenous levels of IRF5 only when phosphorylated at Ser437.
IRF5 (Phospho- Ser437) Antibody
ABF8382 100 ug
EUR 438
IRF5 recombinant monoclonal antibody
A5366 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human IRF5 for WB, IHC,ELISA
Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human)
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (Tyr136~Ala475)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5)
Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse)
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: IRF5 (His3~Glu250)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5)
Rabbit Anti-Human IRF5 monoclonal antibody, clone TO312-06
CABT-L766 100 ul
EUR 777
IRF5 Blocking Peptide
DF6283-BP 1mg
EUR 195
IRF5 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
IRF5 cloning plasmid
CSB-CL011820HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1497
  • Sequence: atgaaccagtccatcccagtggctcccaccccaccccgccgcgtgcggctgaagccctggctggtggcccaggtgaacagctgccagtacccagggcttcaatgggtcaacggggaaaagaaattattctgcatcccctggaggcatgccacaaggcatggtcccagccaggacg
  • Show more
Description: A cloning plasmid for the IRF5 gene.
Anti-IRF5 (2D4)
YF-MA10491 100 ug
EUR 363
Description: Mouse monoclonal to IRF5
Anti-IRF5 (1H6)
YF-MA13857 100 ug
EUR 363
Description: Mouse monoclonal to IRF5

IRF5 Rabbit Polyclonal Antibody

Back To Top