IRF5 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
IRF5 Polyclonal Antibody |
ABP58963-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of IRF5 from Human, Mouse. This IRF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460 |
IRF5 Polyclonal Antibody |
ABP58963-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of IRF5 from Human, Mouse. This IRF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460 |
IRF5 Polyclonal Antibody |
ABP58963-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460
- Applications tips:
|
Description: A polyclonal antibody for detection of IRF5 from Human, Mouse. This IRF5 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human IRF5 protein at amino acid sequence of 380-460 |
IRF5 Polyclonal Antibody |
ES8994-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IRF5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IRF5 Polyclonal Antibody |
ES8994-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IRF5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
IRF5 Rabbit mAb |
A11106-100ul |
Abclonal |
100 ul |
EUR 410 |
IRF5 Rabbit mAb |
A11106-200ul |
Abclonal |
200 ul |
EUR 571 |
IRF5 Rabbit mAb |
A11106-20ul |
Abclonal |
20 ul |
EUR 221 |
IRF5 Rabbit mAb |
A11106-50ul |
Abclonal |
50 ul |
EUR 287 |
IRF5 Rabbit pAb |
A1149-100ul |
Abclonal |
100 ul |
EUR 308 |
IRF5 Rabbit pAb |
A1149-200ul |
Abclonal |
200 ul |
EUR 459 |
IRF5 Rabbit pAb |
A1149-20ul |
Abclonal |
20 ul |
EUR 183 |
IRF5 Rabbit pAb |
A1149-50ul |
Abclonal |
50 ul |
EUR 223 |
IRF5 Rabbit pAb |
A13621-100ul |
Abclonal |
100 ul |
EUR 308 |
IRF5 Rabbit pAb |
A13621-200ul |
Abclonal |
200 ul |
EUR 459 |
IRF5 Rabbit pAb |
A13621-20ul |
Abclonal |
20 ul |
EUR 183 |
IRF5 Rabbit pAb |
A13621-50ul |
Abclonal |
50 ul |
EUR 223 |
IRF5 Rabbit pAb |
A16388-100ul |
Abclonal |
100 ul |
EUR 308 |
IRF5 Rabbit pAb |
A16388-200ul |
Abclonal |
200 ul |
EUR 459 |
IRF5 Rabbit pAb |
A16388-20ul |
Abclonal |
20 ul |
EUR 183 |
IRF5 Rabbit pAb |
A16388-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
DLR-IRF5-Hu-48T |
DL Develop |
48T |
EUR 444 |
- Should the Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
DLR-IRF5-Hu-96T |
DL Develop |
96T |
EUR 573 |
- Should the Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
DLR-IRF5-Mu-48T |
DL Develop |
48T |
EUR 454 |
- Should the Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
DLR-IRF5-Mu-96T |
DL Develop |
96T |
EUR 587 |
- Should the Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Interferon Regulatory Factor 5 (IRF5) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
RDR-IRF5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 458 |
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
RDR-IRF5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 633 |
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
RDR-IRF5-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 470 |
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
RDR-IRF5-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 651 |
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
RD-IRF5-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 439 |
Human Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
RD-IRF5-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 606 |
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
RD-IRF5-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 450 |
Mouse Interferon Regulatory Factor 5 (IRF5) ELISA Kit |
RD-IRF5-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 622 |
Anti-IRF5 Rabbit Monoclonal Antibody |
M00958 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal IRF5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat. |
Anti-IRF5 Rabbit Monoclonal Antibody |
M00958-1 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal IRF5 Antibody. Validated in WB and tested in Human. |
Polyclonal Goat Anti-IRF5 Antibody |
APG00173G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-IRF5 . This antibody is tested and proven to work in the following applications: |
Irf5 Polyclonal Antibody, HRP Conjugated |
A62795 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
Irf5 Polyclonal Antibody, FITC Conjugated |
A62796 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Irf5 Polyclonal Antibody, Biotin Conjugated |
A62797 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
IRF5 antibody |
70R-18009 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal IRF5 antibody |
IRF5 Antibody |
32184-100ul |
SAB |
100ul |
EUR 252 |
IRF5 antibody |
10R-1026 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal IRF5 antibody |
IRF5 Antibody |
49111-100ul |
SAB |
100ul |
EUR 333 |
IRF5 Antibody |
49111-50ul |
SAB |
50ul |
EUR 239 |
IRF5 Antibody |
49123-100ul |
SAB |
100ul |
EUR 333 |
IRF5 Antibody |
49123-50ul |
SAB |
50ul |
EUR 239 |
IRF5 Antibody |
DF6283 |
Affbiotech |
200ul |
EUR 304 |
Description: IRF5 Antibody detects endogenous levels of total IRF5. |
IRF5 Antibody |
1-CSB-PA011820GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
IRF5 Antibody |
1-CSB-PA011820LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
Irf5 Antibody |
1-CSB-PA011820LA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA |
Polyclonal IRF5 antibody - N-terminal region |
APR00727G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IRF5 - N-terminal region. This antibody is tested and proven to work in the following applications: |
IRF5 (Phospho-Ser437) Polyclonal Conjugated Antibody |
C12688 |
SAB |
100ul |
EUR 397 |
IRF5 (pS437) Antibody |
abx216307-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
IRF5 Conjugated Antibody |
C49111 |
SAB |
100ul |
EUR 397 |
IRF5 Conjugated Antibody |
C32184 |
SAB |
100ul |
EUR 397 |
anti- IRF5 antibody |
FNab04391 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: interferon regulatory factor 5
- Uniprot ID: Q13568
- Gene ID: 3663
- Research Area: Epigenetics, Cancer, Immunology, Metabolism
|
Description: Antibody raised against IRF5 |
anti- IRF5 antibody |
FNab04392 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:500 - 1:3000
- Immunogen: interferon regulatory factor 5
- Uniprot ID: Q13568
- Gene ID: 3663
- Research Area: Epigenetics, Cancer, Immunology, Metabolism
|
Description: Antibody raised against IRF5 |
Anti-IRF5 Antibody |
PA2208 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-IRF5 Antibody |
PB9646 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-IRF5 antibody |
STJ24230 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment. |
Anti-IRF5 antibody |
STJ115580 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the interferon regulatory factor (IRF) family, a group of transcription factors with diverse roles, including virus-mediated activation of interferon, and modulation of cell growth, differentiation, apoptosis, and immune system activity. Members of the IRF family are characterized by a conserved N-terminal DNA-binding domain containing tryptophan (W) repeats. Alternative promoter use and alternative splicing result in multiple transcript variants, and a 30-nt indel polymorphism (SNP rs60344245) can result in loss of a 10-aa segment. |
Anti-IRF5 antibody |
STJ190152 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to IRF5 |
IRF5 siRNA |
20-abx920802 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IRF5 siRNA |
20-abx920803 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-IRF5 |
YF-PA12773 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to IRF5 |
anti-IRF5 |
YF-PA12774 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to IRF5 |
IRF5 (Phospho-Ser437) Antibody |
12688-100ul |
SAB |
100ul |
EUR 252 |
IRF5 (Phospho-Ser437) Antibody |
12688-50ul |
SAB |
50ul |
EUR 187 |
IRF5 Antibody, HRP conjugated |
1-CSB-PA011820LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
Irf5 Antibody, HRP conjugated |
1-CSB-PA011820LB01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
IRF5 Antibody, FITC conjugated |
1-CSB-PA011820LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
Irf5 Antibody, FITC conjugated |
1-CSB-PA011820LC01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
IRF5 Antibody, Biotin conjugated |
1-CSB-PA011820LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against IRF5. Recognizes IRF5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Irf5 Antibody, Biotin conjugated |
1-CSB-PA011820LD01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Irf5. Recognizes Irf5 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Phospho-IRF5 (Ser437) Antibody |
AF8382 |
Affbiotech |
200ul |
EUR 376 |
Description: IRF5 (Phospho-Ser437) Antibody detects endogenous levels of IRF5 only when phosphorylated at Ser437. |
IRF5 recombinant monoclonal antibody |
A5366 |
Bimake |
100ul X 3 |
EUR 595 |
- Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
- Show more
|
Description: A recombinant monoclonal antibody from rabbit against human IRF5 for WB, IHC,ELISA |
Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Human) |
4-PAB598Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IRF5 (Tyr136~Ala475)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Interferon Regulatory Factor 5 (IRF5) |
Interferon Regulatory Factor 5 (IRF5) Polyclonal Antibody (Mouse) |
4-PAB598Mu01 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: IRF5 (His3~Glu250)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Mouse Interferon Regulatory Factor 5 (IRF5) |
Rabbit Anti-Human IRF5 monoclonal antibody, clone TO312-06 |
CABT-L766 |
Creative Diagnostics |
100 ul |
EUR 777 |
IRF5 Blocking Peptide |
DF6283-BP |
Affbiotech |
1mg |
EUR 195 |
IRF5 Blocking Peptide |
20-abx161140 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
IRF5 cloning plasmid |
CSB-CL011820HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1497
- Sequence: atgaaccagtccatcccagtggctcccaccccaccccgccgcgtgcggctgaagccctggctggtggcccaggtgaacagctgccagtacccagggcttcaatgggtcaacggggaaaagaaattattctgcatcccctggaggcatgccacaaggcatggtcccagccaggacg
- Show more
|
Description: A cloning plasmid for the IRF5 gene. |
Anti-IRF5 (2D4) |
YF-MA10491 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to IRF5 |
Anti-IRF5 (1H6) |
YF-MA13857 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to IRF5 |
IRF5 Rabbit Polyclonal Antibody