KIF1C Rabbit Polyclonal Antibody

KIF1C Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

KIF1C Polyclonal Antibody

ABP59046-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190
  • Applications tips:
Description: A polyclonal antibody for detection of KIF1C from Human, Mouse, Rat. This KIF1C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190

KIF1C Polyclonal Antibody

ABP59046-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190
  • Applications tips:
Description: A polyclonal antibody for detection of KIF1C from Human, Mouse, Rat. This KIF1C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190

KIF1C Polyclonal Antibody

ABP59046-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190
  • Applications tips:
Description: A polyclonal antibody for detection of KIF1C from Human, Mouse, Rat. This KIF1C antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KIF1C protein at amino acid sequence of 1110-1190

Kif1c Polyclonal Antibody

A56663 100 µg
EUR 570.55
Description: reagents widely cited

KIF1C Rabbit pAb

A15786-100ul 100 ul
EUR 308

KIF1C Rabbit pAb

A15786-200ul 200 ul
EUR 459

KIF1C Rabbit pAb

A15786-20ul 20 ul
EUR 183

KIF1C Rabbit pAb

A15786-50ul 50 ul
EUR 223

KIF1C Antibody

36569-100ul 100ul
EUR 252

KIF1C antibody

70R-18115 50 ul
EUR 435
Description: Rabbit polyclonal KIF1C antibody

KIF1C antibody

70R-1611 100 ug
EUR 377
Description: Rabbit polyclonal KIF1C antibody raised against the C terminal of KIF1C

KIF1C Antibody

1-CSB-PA969739
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIF1C. Recognizes KIF1C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KIF1C Antibody

1-CSB-PA012320GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KIF1C. Recognizes KIF1C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Kif1c Antibody

1-CSB-PA012320LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Kif1c. Recognizes Kif1c from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

KIF1C Antibody

1-CSB-PA175695
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KIF1C. Recognizes KIF1C from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

Kif1c Polyclonal Antibody, HRP Conjugated

A56664 100 µg
EUR 570.55
Description: Ask the seller for details

Kif1c Polyclonal Antibody, FITC Conjugated

A56665 100 µg
EUR 570.55
Description: The best epigenetics products

Kif1c Polyclonal Antibody, Biotin Conjugated

A56666 100 µg
EUR 570.55
Description: kits suitable for this type of research

Kif1c/ Rat Kif1c ELISA Kit

ELI-28101r 96 Tests
EUR 886

KIF1C Conjugated Antibody

C36569 100ul
EUR 397

anti- KIF1C antibody

FNab04556 100µg
EUR 505.25
  • Immunogen: kinesin family member 1C
  • Uniprot ID: O43896
  • Gene ID: 10749
  • Research Area: Cell Division and Proliferation, Developmental biology
Description: Antibody raised against KIF1C

Anti-KIF1C antibody

PAab04556 100 ug
EUR 355

Anti-KIF1C antibody

STJ118245 100 µl
EUR 277

Anti-KIF1C antibody

STJ190107 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to KIF1C

Rat Kinesin-like protein KIF1C (Kif1c)

1-CSB-YP012320RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Kinesin-like protein KIF1C(Kif1c) ,partial expressed in Yeast

Rat Kinesin-like protein KIF1C (Kif1c)

1-CSB-EP012320RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 46.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Kinesin-like protein KIF1C(Kif1c) expressed in E.coli

KIF1C siRNA

20-abx902842
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIF1C siRNA

20-abx921600
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIF1C siRNA

20-abx921601
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Kif1c Antibody, HRP conjugated

1-CSB-PA012320LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Kif1c. Recognizes Kif1c from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Kif1c Antibody, FITC conjugated

1-CSB-PA012320LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Kif1c. Recognizes Kif1c from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Kif1c Antibody, Biotin conjugated

1-CSB-PA012320LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Kif1c. Recognizes Kif1c from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Kinesin- like protein KIF1C, Kif1c ELISA KIT

ELI-15858m 96 Tests
EUR 865

Human Kinesin- like protein KIF1C, KIF1C ELISA KIT

ELI-08130h 96 Tests
EUR 824

KIF1C cloning plasmid

CSB-CL012320HU-10ug 10ug
EUR 1214
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3312
  • Sequence: atggctggtgcctcggtgaaagtggcagtgagggttcggccctttaacgcccgtgagaccagccaggatgccaagtgtgtggtcagcatgcagggcaacaccacctccatcatcaatcctaaacagagcaaggatgcccccaaaagcttcacctttgactactcctactggtcac
  • Show more
Description: A cloning plasmid for the KIF1C gene.

KIF1C Blocking Peptide

33R-3283 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIF1C antibody, catalog no. 70R-1611

Anti-KIF1C (1F12)

YF-MA17471 100 ug
EUR 363
Description: Mouse monoclonal to KIF1C

Kinesin-like Protein KIF1C (Phospho-Ser1092) Polyclonal Conjugated Antibody

C12459 100ul
EUR 397

Rat KIF1C shRNA Plasmid

20-abx987106
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KIF1C ELISA KIT|Human

EF010514 96 Tests
EUR 689

Human KIF1C shRNA Plasmid

20-abx957325
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse KIF1C shRNA Plasmid

20-abx971181
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Kinesin Family Member 1C (KIF1C) Antibody

20-abx113383
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kinesin Family Member 1C (KIF1C) Antibody

20-abx110446
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Kinesin Family Member 1C (KIF1C) Antibody

abx146469-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

KIF1C Rabbit Polyclonal Antibody

Back To Top