LATS1/2 antibody

LATS1/2 antibody

To Order: garrett@bioworldantibodies.com

Serine/threonine-Protein Kinase LATS1/2 (LATS1/2) Antibody

20-abx141092
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase LATS1/2 (LATS1/2) Antibody

20-abx012918
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

LATS1/2 Conjugated Antibody

C33232 100ul
EUR 397

LATS1/2 Polyclonal Antibody

ES2704-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LATS1/2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

LATS1/2 Polyclonal Antibody

ES2704-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LATS1/2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

LATS1/2 Polyclonal Antibody

ABP59096-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LATS1/2 antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse, Rat. This LATS1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 antibody protein

LATS1/2 Polyclonal Antibody

ABP59096-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LATS1/2 antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse, Rat. This LATS1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 antibody protein

LATS1/2 Polyclonal Antibody

ABP59096-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LATS1/2 antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse, Rat. This LATS1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 antibody protein

LATS1/2 Polyclonal Antibody

ABP51705-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse. This LATS1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041

LATS1/2 Polyclonal Antibody

ABP51705-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse. This LATS1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041

LATS1/2 Polyclonal Antibody

ABP51705-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse. This LATS1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041

Anti-LATS1/2 Antibody

A01051 100ul
EUR 397
Description: Rabbit Polyclonal LATS1/2 Antibody. Validated in IHC and tested in Human.

Anti-LATS1/2 Antibody

A01051-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for LATS1/2 Antibody (LATS1) detection.tested for WB in Human, Mouse.

Anti-LATS1/2 antibody

STJ93908 200 µl
EUR 197
Description: Rabbit polyclonal to LATS1/2.

Anti-LATS1/2 antibody

STJ99623 200 µl
EUR 197
Description: Rabbit polyclonal to LATS1/2.

LATS1 Antibody

AF7669 200ul
EUR 376
Description: LATS1 Antibody detects endogenous levels of LATS1.

LATS1 Antibody

AF7670 200ul
EUR 376
Description: LATS1 Antibody detects endogenous levels of LATS1.

LATS1 Antibody

AF7671 200ul
EUR 376
Description: LATS1 Antibody detects endogenous levels of LATS1.

LATS1 antibody

70R-51351 100 ul
EUR 244
Description: Purified Polyclonal LATS1 antibody

LATS1 antibody

70R-5683 50 ug
EUR 467
Description: Rabbit polyclonal LATS1 antibody

lats1 Antibody

ABD7517 100 ug
EUR 438

LATS1 Antibody

36187-100ul 100ul
EUR 252

LATS1 antibody

70R-18222 50 ul
EUR 435
Description: Rabbit polyclonal LATS1 antibody

LATS1 Antibody

1-CSB-PA830665
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

LATS1 Antibody

1-CSB-PA012769GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LATS1 Antibody

1-CSB-PA012769LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:500, IP:1:200-1:2000

LATS1 / 2 (pS909 / 872) Antibody

abx216529-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

LATS1 / 2 Blocking Peptide

20-abx061790
  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

lats1/2 Blocking Peptide

DF7517-BP 1mg
EUR 195

LATS1 Conjugated Antibody

C36187 100ul
EUR 397

anti- LATS1 antibody

FNab04708 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:20-1:200
  • Immunogen: LATS, large tumor suppressor, homolog 1
  • Uniprot ID: O95835
  • Gene ID: 9113
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against LATS1

LATS1 / LATS2 Antibody

20-abx325262
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

LATS1 / LATS2 Antibody

abx331369-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

LATS1/LATS2 Antibody

1-CSB-PA003141
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LATS1/LATS2. Recognizes LATS1/LATS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

LATS1/LATS2 Antibody

CSB-PA069135-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against LATS1/LATS2. Recognizes LATS1/LATS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

LATS1/LATS2 Antibody

CSB-PA069135-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against LATS1/LATS2. Recognizes LATS1/LATS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

Anti-LATS1 antibody

PAab04708 100 ug
EUR 355

Anti-LATS1 antibody

STJ11100931 100 µl
EUR 393
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments.

Anti-LATS1 antibody

STJ119966 100 µl
EUR 277
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments.

Phospho-LATS1/2 (Ser909/872) Antibody

AF8163 200ul
EUR 376
Description: LATS1/2 (Phospho-Ser909/872) Antibody detects endogenous levels of LATS1/2 only when phosphorylated at Ser909/872.

LATS1 / 2 (Phospho-Thr1079 / 1041) Antibody

20-abx012605
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

LATS1/2 (Phospho- Ser909/872) Antibody

ABF8163 100 ug
EUR 438

LATS1/2 (Phospho-Ser909/872) Antibody

12514-100ul 100ul
EUR 252

LATS1/2 (Phospho-Ser909/872) Antibody

12514-50ul 50ul
EUR 187

LATS1/2 (Phospho-Thr1079/1041) Antibody

11736-100ul 100ul
EUR 252

LATS1/2 (Phospho-Thr1079/1041) Antibody

11736-50ul 50ul
EUR 187

LATS1 siRNA

20-abx922294
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LATS1 siRNA

20-abx922295
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody

ES7961-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against LATS1/2 (phospho Thr1079/1041) from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody

ES7961-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against LATS1/2 (phospho Thr1079/1041) from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA

LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody

ABP56962-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 phospho Thr1079/1041) from Human, Mouse. This LATS1/2 phospho Thr1079/1041) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041

LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody

ABP56962-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 phospho Thr1079/1041) from Human, Mouse. This LATS1/2 phospho Thr1079/1041) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041

LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody

ABP56962-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 phospho Thr1079/1041) from Human, Mouse. This LATS1/2 phospho Thr1079/1041) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041

LATS1/2 (Phospho-Thr1079/1041) Polyclonal Antibody

ABP59095-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 Phospho-Thr1079/1041) from Human, Mouse, Rat. This LATS1/2 Phospho-Thr1079/1041) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein

LATS1/2 (Phospho-Thr1079/1041) Polyclonal Antibody

ABP59095-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 Phospho-Thr1079/1041) from Human, Mouse, Rat. This LATS1/2 Phospho-Thr1079/1041) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein

LATS1/2 (Phospho-Thr1079/1041) Polyclonal Antibody

ABP59095-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein
  • Applications tips:
Description: A polyclonal antibody for detection of LATS1/2 Phospho-Thr1079/1041) from Human, Mouse, Rat. This LATS1/2 Phospho-Thr1079/1041) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein

Anti-Phospho-LATS1/2 (T1079/1041) antibody

STJ91207 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-LATS1/2 (T1079/1041).

Anti-Phospho-LATS1/2 (Thr1079/1041) antibody

STJ99599 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-LATS1/2 (Thr1079/1041).

Phospho-LATS1 (Thr1079) Antibody

AF7169 200ul
EUR 376
Description: Phospho-LATS1 (Thr1079) Antibody detects endogenous levels of LATS1 only when phosphorylated at Thr1079.

Phospho-LATS1 (Ser909) Antibody

AF7170 200ul
EUR 376
Description: Phospho-LATS1 (Ser909) Antibody detects endogenous levels of LATS1 only when phosphorylated at Ser909.

Phospho-LATS1 (Tyr283) Antibody

AF7171 200ul
EUR 376
Description: Phospho-LATS1 (Tyr283) Antibody detects endogenous levels of LATS1 only when phosphorylated at Tyr283.

Phospho- LATS1 (Thr1079) Antibody

ABF3638 100 ug
EUR 438

LATS1 (Phospho-Thr1079) Antibody

13032-100ul 100ul
EUR 252

LATS1 (Phospho-Thr1079) Antibody

13032-50ul 50ul
EUR 187

LATS1 (Phospho-Ser909) Antibody

13033-100ul 100ul
EUR 252

LATS1 (Phospho-Ser909) Antibody

13033-50ul 50ul
EUR 187

LATS1 (Phospho-Tyr283) Antibody

13034-100ul 100ul
EUR 252

LATS1 (Phospho-Tyr283) Antibody

13034-50ul 50ul
EUR 187

LATS1/LATS2 Polyclonal Antibody

30393-100ul 100ul
EUR 252

LATS1/LATS2 Polyclonal Antibody

30393-50ul 50ul
EUR 187

LATS1 Antibody, HRP conjugated

1-CSB-PA012769LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LATS1 Antibody, FITC conjugated

1-CSB-PA012769LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LATS1 Antibody, Biotin conjugated

1-CSB-PA012769LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-LATS1/LATS2 antibody

STJ11100242 100 µl
EUR 277

LATS1/2 (Phospho-Thr1079/1041) Polyclonal Conjugated Antibody

C11736 100ul
EUR 397

LATS1/2 (Phospho-Ser909/872) Polyclonal Conjugated Antibody

C12514 100ul
EUR 397

LATS1 Blocking Peptide

AF7669-BP 1mg
EUR 195

LATS1 Blocking Peptide

AF7670-BP 1mg
EUR 195

LATS1 Blocking Peptide

AF7671-BP 1mg
EUR 195

LATS1 cloning plasmid

CSB-CL012769HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 408
  • Sequence: atgaagaggagtgaaaagccagaaggatatagacaaatgaggcctaagacctttcctgccagtaactatactgtcagtagccggcaaatgttacaagaaattcgggaatcccttaggaatttatctaaaccatctgatgctgctaaggctgagcataacatgagtaaaatgtcaac
  • Show more
Description: A cloning plasmid for the LATS1 gene.

LATS1 cloning plasmid

CSB-CL012769HU2-10ug 10ug
EUR 691
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2073
  • Sequence: atgaagaggagtgaaaagccagaaggatatagacaaatgaggcctaagacctttcctgccagtaactatactgtcagtagccggcaaatgttacaagaaattcgggaatcccttaggaatttatctaaaccatctgatgctgctaaggctgagcataacatgagtaaaatgtcaa
  • Show more
Description: A cloning plasmid for the LATS1 gene.

LATS1 Blocking Peptide

20-abx064226
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

LATS1 Rabbit pAb

A7159-100ul 100 ul
EUR 384

LATS1 Rabbit pAb

A7159-200ul 200 ul Ask for price

LATS1 Rabbit pAb

A7159-20ul 20 ul Ask for price

LATS1 Rabbit pAb

A7159-50ul 50 ul
EUR 265

LATS1 Rabbit pAb

A17992-100ul 100 ul
EUR 308

LATS1 Rabbit pAb

A17992-200ul 200 ul
EUR 459

LATS1 Rabbit pAb

A17992-20ul 20 ul
EUR 183

LATS1 Rabbit pAb

A17992-50ul 50 ul
EUR 223

LATS1 Blocking Peptide

33R-4095 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LATS1 antibody, catalog no. 70R-5683

Anti-LATS1 (3A7)

YF-MA16671 100 ug
EUR 363
Description: Mouse monoclonal to LATS1

LATS1/LATS2 Polyclonal Conjugated Antibody

C30393 100ul
EUR 397

LATS1 (Phospho-Thr1079) Conjugated Antibody

C13032 100ul
EUR 397

LATS1 (Phospho-Ser909) Conjugated Antibody

C13033 100ul
EUR 397

LATS1 (Phospho-Tyr283) Conjugated Antibody

C13034 100ul
EUR 397

LATS1 / LATS2 (pT1079 / 1041) Antibody

20-abx325183
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

LATS1 / LATS2 (pT1079 / 1041) Antibody

abx332955-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Antibody for Human LATS1 (pSer909)

SPC-1005D 0.1ml
EUR 354
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is unconjugated.

Antibody for Human LATS1 (pSer909)

SPC-1005D-A390 0.1ml
EUR 401
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 390.

Antibody for Human LATS1 (pSer909)

SPC-1005D-A488 0.1ml
EUR 400
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 488.

Antibody for Human LATS1 (pSer909)

SPC-1005D-A565 0.1ml
EUR 400
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 565.

Antibody for Human LATS1 (pSer909)

SPC-1005D-A594 0.1ml
EUR 400
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 594.

Antibody for Human LATS1 (pSer909)

SPC-1005D-A633 0.1ml
EUR 400
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 633.

Antibody for Human LATS1 (pSer909)

SPC-1005D-A655 0.1ml
EUR 400
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 655.

Antibody for Human LATS1 (pSer909)

SPC-1005D-A680 0.1ml
EUR 400
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 680.

Antibody for Human LATS1 (pSer909)

SPC-1005D-A700 0.1ml
EUR 400
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 700.

Antibody for Human LATS1 (pSer909)

SPC-1005D-ALP 0.1ml
EUR 394
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Alkaline Phosphatase.

Antibody for Human LATS1 (pSer909)

SPC-1005D-APC 0.1ml
EUR 399
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to APC .

Antibody for Human LATS1 (pSer909)

SPC-1005D-APCCY7 0.1ml
EUR 471
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to APC/Cy7.

Antibody for Human LATS1 (pSer909)

SPC-1005D-BI 0.1ml
EUR 396
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Biotin.

Antibody for Human LATS1 (pSer909)

SPC-1005D-DY350 0.1ml
EUR 475
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 350.

Antibody for Human LATS1 (pSer909)

SPC-1005D-DY405 0.1ml
EUR 452
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 405.

Antibody for Human LATS1 (pSer909)

SPC-1005D-DY488 0.1ml
EUR 432
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 488.

Antibody for Human LATS1 (pSer909)

SPC-1005D-DY594 0.1ml
EUR 436
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 594.

Antibody for Human LATS1 (pSer909)

SPC-1005D-DY633 0.1ml
EUR 426
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 633.

Antibody for Human LATS1 (pSer909)

SPC-1005D-FITC 0.1ml
EUR 392
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to FITC.

Antibody for Human LATS1 (pSer909)

SPC-1005D-HRP 0.1ml
EUR 388
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to HRP.

Antibody for Human LATS1 (pSer909)

SPC-1005D-P594 0.1ml
EUR 407
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to PE/ATTO 594.

Antibody for Human LATS1 (pSer909)

SPC-1005D-PCP 0.1ml
EUR 399
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to PerCP.

Antibody for Human LATS1 (pSer909)

SPC-1005D-RPE 0.1ml
EUR 397
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to RPE .

Antibody for Human LATS1 (pSer909)

SPC-1005D-STR 0.1ml
EUR 398
  • LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
  • Show more
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Streptavidin.

Human LATS1(Serine/threonine-protein kinase LATS1) ELISA Kit

EH9736 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Serine/threonine- protein kinase LATS1, LATS1 ELISA KIT

ELI-36986h 96 Tests
EUR 824

Mouse Serine/threonine- protein kinase LATS1, Lats1 ELISA KIT

ELI-42693m 96 Tests
EUR 865

Phospho-LATS1/2 (Ser909/872) Blocking Peptide

AF8163-BP 1mg
EUR 195

Lats1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3825503 1.0 ug DNA
EUR 154

LATS1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1198203 1.0 ug DNA
EUR 154

Phospho-LATS1/LATS2 (Thr1079/1041) Antibody

CSB-PA905508-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-LATS1/LATS2 (Thr1079/1041). Recognizes Phospho-LATS1/LATS2 (Thr1079/1041) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

Phospho-LATS1/LATS2 (Thr1079/1041) Antibody

CSB-PA905508-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-LATS1/LATS2 (Thr1079/1041). Recognizes Phospho-LATS1/LATS2 (Thr1079/1041) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

Phospho-LATS1/LATS2 (T1079/1041) Antibody

1-CSB-PA070231
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-LATS1/LATS2 (T1079/1041). Recognizes Phospho-LATS1/LATS2 (T1079/1041) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000

LATS1 ELISA KIT|Human

EF010629 96 Tests
EUR 689

Human LATS1 shRNA Plasmid

20-abx956022
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LATS1/LATS2 Rabbit pAb

A18286-100ul 100 ul
EUR 308

LATS1/LATS2 Rabbit pAb

A18286-200ul 200 ul
EUR 459

LATS1/LATS2 Rabbit pAb

A18286-20ul 20 ul
EUR 183

LATS1/LATS2 Rabbit pAb

A18286-50ul 50 ul
EUR 223

Mouse LATS1 shRNA Plasmid

20-abx971282
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-ErbB 2/ERBB2 Antibody

A00010-2 100ug/vial
EUR 334

Anti-Bcl-2/BCL2 Antibody

A00040-2 100ug/vial
EUR 334

Anti-Angiopoietin-2/ANGPT2 Antibody

A00370-2 100ug/vial
EUR 334

Anti-EIF4A1/2/3 Antibody

A03922-2 100ug/vial
EUR 334

Anti-Fascin 2/FSCN2 Antibody

A07840-2 100ug/vial
EUR 294

Large Tumor Suppressor Kinase 1 (LATS1) Antibody

20-abx113445
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Large Tumor Suppressor Kinase 1 (LATS1) Antibody

abx033135-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Large Tumor Suppressor Kinase 1 (LATS1) Antibody

abx033135-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Large Tumor Suppressor Kinase 1 (LATS1) Antibody

20-abx007804
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Large Tumor Suppressor Kinase 1 (LATS1) Antibody

20-abx312862
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Large Tumor Suppressor Kinase 1 (lats1) Antibody

abx216530-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Large Tumor Suppressor Kinase 1 (LATS1) Antibody

abx234708-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Large Tumor Suppressor Kinase 1 (LATS1) Antibody

20-abx210537
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Anti-phospho-LATS1-S909/LATS2-S872 antibody

STJ11101017 50 µl
EUR 393
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments.

Anti-phospho-LATS1-T1079/LATS2-T1041 antibody

STJ11101018 50 µl
EUR 393
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments.

Anti-phospho-LATS1-S909/LATS2-S872 antibody

STJ11101039 100 µl
EUR 393
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments.

Anti-phospho-LATS1-T1079/LATS2-T1041 antibody

STJ11101047 100 µl
EUR 393
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments.

Anti-COX2/Cyclooxygenase 2/PTGS2 Antibody

A00084-2 100ug/vial
EUR 294

Anti-beta 2 Microglobulin/B2m Antibody

A00456-2 100ug/vial
EUR 294

Anti-VEGF Receptor 2/KDR Antibody

A00901-2 100ug/vial
EUR 334

Anti-Adiponectin Receptor 2 (mouse) Antibody

A02218-2 200ug
EUR 498
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.

Anti-Anterior Gradient 2/AGR2 Antibody

A02922-2 100ug/vial
EUR 334

Anti-p56Dok-2 (Ab-299) Antibody

A07956-2 100ul
EUR 397
Description: Rabbit Polyclonal p56Dok-2 (Ab-299) Antibody. Validated in IF, IHC, WB and tested in Human.

Anti-Bcl-2 Rabbit Monoclonal Antibody

M00040-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-HIF-2-alpha/EPAS1 Antibody

PA1129-2 100ug/vial
EUR 294

Phospho-LATS1 (Thr1079) Blocking Peptide

AF7169-BP 1mg
EUR 195

Phospho-LATS1 (Ser909) Blocking Peptide

AF7170-BP 1mg
EUR 195

Phospho-LATS1 (Tyr283) Blocking Peptide

AF7171-BP 1mg
EUR 195

LATS1 ORF Vector (Human) (pORF)

ORF005858 1.0 ug DNA
EUR 95

LATS1 ORF Vector (Human) (pORF)

ORF005859 1.0 ug DNA
EUR 95

Lats1 ORF Vector (Mouse) (pORF)

ORF048977 1.0 ug DNA
EUR 506

pECMV-Lats1-m-FLAG Plasmid

PVT14956 2 ug
EUR 325

LATS1 ELISA Kit (Human) (OKEH07987)

OKEH07987 96 Wells
EUR 896
Description: Description of target: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

Anti-Beta 2 Microglobulin Antibody (monoclonal, 2H10)

M00456-2 100ug/vial
EUR 334

LATS1/2 antibody

Back To Top