LATS1/2 antibody
To Order: garrett@bioworldantibodies.com
Serine/threonine-Protein Kinase LATS1/2 (LATS1/2) Antibody |
20-abx141092 |
Abbexa |
-
EUR 356.00
-
EUR 537.00
-
EUR 217.00
|
|
- Shipped within 5-10 working days.
|
Serine/threonine-Protein Kinase LATS1/2 (LATS1/2) Antibody |
20-abx012918 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
LATS1/2 Conjugated Antibody |
C33232 |
SAB |
100ul |
EUR 397 |
LATS1/2 Polyclonal Antibody |
ES2704-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against LATS1/2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
LATS1/2 Polyclonal Antibody |
ES2704-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LATS1/2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA |
LATS1/2 Polyclonal Antibody |
ABP59096-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human LATS1/2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse, Rat. This LATS1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 antibody protein |
LATS1/2 Polyclonal Antibody |
ABP59096-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LATS1/2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse, Rat. This LATS1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 antibody protein |
LATS1/2 Polyclonal Antibody |
ABP59096-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LATS1/2 antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse, Rat. This LATS1/2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 antibody protein |
LATS1/2 Polyclonal Antibody |
ABP51705-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse. This LATS1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041 |
LATS1/2 Polyclonal Antibody |
ABP51705-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse. This LATS1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041 |
LATS1/2 Polyclonal Antibody |
ABP51705-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 from Human, Mouse. This LATS1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the non-phosphorylation site of T1079/1041 |
Anti-LATS1/2 Antibody |
A01051 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal LATS1/2 Antibody. Validated in IHC and tested in Human. |
Anti-LATS1/2 Antibody |
A01051-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for LATS1/2 Antibody (LATS1) detection.tested for WB in Human, Mouse. |
Anti-LATS1/2 antibody |
STJ93908 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to LATS1/2. |
Anti-LATS1/2 antibody |
STJ99623 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to LATS1/2. |
LATS1 Antibody |
AF7669 |
Affbiotech |
200ul |
EUR 376 |
Description: LATS1 Antibody detects endogenous levels of LATS1. |
LATS1 Antibody |
AF7670 |
Affbiotech |
200ul |
EUR 376 |
Description: LATS1 Antibody detects endogenous levels of LATS1. |
LATS1 Antibody |
AF7671 |
Affbiotech |
200ul |
EUR 376 |
Description: LATS1 Antibody detects endogenous levels of LATS1. |
LATS1 antibody |
70R-51351 |
Fitzgerald |
100 ul |
EUR 244 |
Description: Purified Polyclonal LATS1 antibody |
LATS1 antibody |
70R-5683 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal LATS1 antibody |
LATS1 Antibody |
36187-100ul |
SAB |
100ul |
EUR 252 |
LATS1 antibody |
70R-18222 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal LATS1 antibody |
LATS1 Antibody |
1-CSB-PA830665 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
LATS1 Antibody |
1-CSB-PA012769GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
LATS1 Antibody |
1-CSB-PA012769LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF, IP; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:500, IP:1:200-1:2000 |
LATS1 / 2 (pS909 / 872) Antibody |
abx216529-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
LATS1 / 2 Blocking Peptide |
20-abx061790 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
lats1/2 Blocking Peptide |
DF7517-BP |
Affbiotech |
1mg |
EUR 195 |
LATS1 Conjugated Antibody |
C36187 |
SAB |
100ul |
EUR 397 |
anti- LATS1 antibody |
FNab04708 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:200-1:1000
- IHC: 1:20-1:200
- Immunogen: LATS, large tumor suppressor, homolog 1
- Uniprot ID: O95835
- Gene ID: 9113
- Research Area: Signal Transduction, Metabolism
|
Description: Antibody raised against LATS1 |
LATS1 / LATS2 Antibody |
20-abx325262 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LATS1 / LATS2 Antibody |
abx331369-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
LATS1/LATS2 Antibody |
1-CSB-PA003141 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against LATS1/LATS2. Recognizes LATS1/LATS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000 |
LATS1/LATS2 Antibody |
CSB-PA069135- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against LATS1/LATS2. Recognizes LATS1/LATS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
LATS1/LATS2 Antibody |
CSB-PA069135-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against LATS1/LATS2. Recognizes LATS1/LATS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
Anti-LATS1 antibody |
STJ11100931 |
St John's Laboratory |
100 µl |
EUR 393 |
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. |
Anti-LATS1 antibody |
STJ119966 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. |
Phospho-LATS1/2 (Ser909/872) Antibody |
AF8163 |
Affbiotech |
200ul |
EUR 376 |
Description: LATS1/2 (Phospho-Ser909/872) Antibody detects endogenous levels of LATS1/2 only when phosphorylated at Ser909/872. |
LATS1 / 2 (Phospho-Thr1079 / 1041) Antibody |
20-abx012605 |
Abbexa |
-
EUR 314.00
-
EUR 98.00
-
EUR 398.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
200 ug
-
300 µg
|
- Shipped within 5-10 working days.
|
LATS1/2 (Phospho-Ser909/872) Antibody |
12514-100ul |
SAB |
100ul |
EUR 252 |
LATS1/2 (Phospho-Ser909/872) Antibody |
12514-50ul |
SAB |
50ul |
EUR 187 |
LATS1/2 (Phospho-Thr1079/1041) Antibody |
11736-100ul |
SAB |
100ul |
EUR 252 |
LATS1/2 (Phospho-Thr1079/1041) Antibody |
11736-50ul |
SAB |
50ul |
EUR 187 |
LATS1 siRNA |
20-abx922294 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LATS1 siRNA |
20-abx922295 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody |
ES7961-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against LATS1/2 (phospho Thr1079/1041) from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA |
LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody |
ES7961-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against LATS1/2 (phospho Thr1079/1041) from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA |
LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody |
ABP56962-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 phospho Thr1079/1041) from Human, Mouse. This LATS1/2 phospho Thr1079/1041) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041 |
LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody |
ABP56962-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 phospho Thr1079/1041) from Human, Mouse. This LATS1/2 phospho Thr1079/1041) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041 |
LATS1/2 (phospho Thr1079/1041) Polyclonal Antibody |
ABP56962-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 phospho Thr1079/1041) from Human, Mouse. This LATS1/2 phospho Thr1079/1041) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human LATS1/2 around the phosphorylation site of T1079/1041 |
LATS1/2 (Phospho-Thr1079/1041) Polyclonal Antibody |
ABP59095-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 Phospho-Thr1079/1041) from Human, Mouse, Rat. This LATS1/2 Phospho-Thr1079/1041) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein |
LATS1/2 (Phospho-Thr1079/1041) Polyclonal Antibody |
ABP59095-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 Phospho-Thr1079/1041) from Human, Mouse, Rat. This LATS1/2 Phospho-Thr1079/1041) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein |
LATS1/2 (Phospho-Thr1079/1041) Polyclonal Antibody |
ABP59095-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein
- Applications tips:
|
Description: A polyclonal antibody for detection of LATS1/2 Phospho-Thr1079/1041) from Human, Mouse, Rat. This LATS1/2 Phospho-Thr1079/1041) antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LATS1/2 (Phospho-Thr1079/1041) Antibody protein |
Anti-Phospho-LATS1/2 (T1079/1041) antibody |
STJ91207 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Phospho-LATS1/2 (T1079/1041). |
Anti-Phospho-LATS1/2 (Thr1079/1041) antibody |
STJ99599 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Phospho-LATS1/2 (Thr1079/1041). |
Phospho-LATS1 (Thr1079) Antibody |
AF7169 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-LATS1 (Thr1079) Antibody detects endogenous levels of LATS1 only when phosphorylated at Thr1079. |
Phospho-LATS1 (Ser909) Antibody |
AF7170 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-LATS1 (Ser909) Antibody detects endogenous levels of LATS1 only when phosphorylated at Ser909. |
Phospho-LATS1 (Tyr283) Antibody |
AF7171 |
Affbiotech |
200ul |
EUR 376 |
Description: Phospho-LATS1 (Tyr283) Antibody detects endogenous levels of LATS1 only when phosphorylated at Tyr283. |
LATS1 (Phospho-Thr1079) Antibody |
13032-100ul |
SAB |
100ul |
EUR 252 |
LATS1 (Phospho-Thr1079) Antibody |
13032-50ul |
SAB |
50ul |
EUR 187 |
LATS1 (Phospho-Ser909) Antibody |
13033-100ul |
SAB |
100ul |
EUR 252 |
LATS1 (Phospho-Ser909) Antibody |
13033-50ul |
SAB |
50ul |
EUR 187 |
LATS1 (Phospho-Tyr283) Antibody |
13034-100ul |
SAB |
100ul |
EUR 252 |
LATS1 (Phospho-Tyr283) Antibody |
13034-50ul |
SAB |
50ul |
EUR 187 |
LATS1/LATS2 Polyclonal Antibody |
30393-100ul |
SAB |
100ul |
EUR 252 |
LATS1/LATS2 Polyclonal Antibody |
30393-50ul |
SAB |
50ul |
EUR 187 |
LATS1 Antibody, HRP conjugated |
1-CSB-PA012769LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
LATS1 Antibody, FITC conjugated |
1-CSB-PA012769LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
LATS1 Antibody, Biotin conjugated |
1-CSB-PA012769LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against LATS1. Recognizes LATS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
LATS1/2 (Phospho-Thr1079/1041) Polyclonal Conjugated Antibody |
C11736 |
SAB |
100ul |
EUR 397 |
LATS1/2 (Phospho-Ser909/872) Polyclonal Conjugated Antibody |
C12514 |
SAB |
100ul |
EUR 397 |
LATS1 Blocking Peptide |
AF7669-BP |
Affbiotech |
1mg |
EUR 195 |
LATS1 Blocking Peptide |
AF7670-BP |
Affbiotech |
1mg |
EUR 195 |
LATS1 Blocking Peptide |
AF7671-BP |
Affbiotech |
1mg |
EUR 195 |
LATS1 cloning plasmid |
CSB-CL012769HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 408
- Sequence: atgaagaggagtgaaaagccagaaggatatagacaaatgaggcctaagacctttcctgccagtaactatactgtcagtagccggcaaatgttacaagaaattcgggaatcccttaggaatttatctaaaccatctgatgctgctaaggctgagcataacatgagtaaaatgtcaac
- Show more
|
Description: A cloning plasmid for the LATS1 gene. |
LATS1 cloning plasmid |
CSB-CL012769HU2-10ug |
Cusabio |
10ug |
EUR 691 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2073
- Sequence: atgaagaggagtgaaaagccagaaggatatagacaaatgaggcctaagacctttcctgccagtaactatactgtcagtagccggcaaatgttacaagaaattcgggaatcccttaggaatttatctaaaccatctgatgctgctaaggctgagcataacatgagtaaaatgtcaa
- Show more
|
Description: A cloning plasmid for the LATS1 gene. |
LATS1 Blocking Peptide |
20-abx064226 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LATS1 Rabbit pAb |
A7159-100ul |
Abclonal |
100 ul |
EUR 384 |
LATS1 Rabbit pAb |
A7159-200ul |
Abclonal |
200 ul |
Ask for price |
LATS1 Rabbit pAb |
A7159-20ul |
Abclonal |
20 ul |
Ask for price |
LATS1 Rabbit pAb |
A7159-50ul |
Abclonal |
50 ul |
EUR 265 |
LATS1 Rabbit pAb |
A17992-100ul |
Abclonal |
100 ul |
EUR 308 |
LATS1 Rabbit pAb |
A17992-200ul |
Abclonal |
200 ul |
EUR 459 |
LATS1 Rabbit pAb |
A17992-20ul |
Abclonal |
20 ul |
EUR 183 |
LATS1 Rabbit pAb |
A17992-50ul |
Abclonal |
50 ul |
EUR 223 |
LATS1 Blocking Peptide |
33R-4095 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LATS1 antibody, catalog no. 70R-5683 |
Anti-LATS1 (3A7) |
YF-MA16671 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to LATS1 |
LATS1/LATS2 Polyclonal Conjugated Antibody |
C30393 |
SAB |
100ul |
EUR 397 |
LATS1 (Phospho-Thr1079) Conjugated Antibody |
C13032 |
SAB |
100ul |
EUR 397 |
LATS1 (Phospho-Ser909) Conjugated Antibody |
C13033 |
SAB |
100ul |
EUR 397 |
LATS1 (Phospho-Tyr283) Conjugated Antibody |
C13034 |
SAB |
100ul |
EUR 397 |
LATS1 / LATS2 (pT1079 / 1041) Antibody |
20-abx325183 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LATS1 / LATS2 (pT1079 / 1041) Antibody |
abx332955-100ul |
Abbexa |
100 ul |
EUR 467 |
- Shipped within 5-10 working days.
|
Antibody for Human LATS1 (pSer909) |
SPC-1005D |
Stressmarq |
0.1ml |
EUR 354 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is unconjugated. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-A390 |
Stressmarq |
0.1ml |
EUR 401 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 390. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-A488 |
Stressmarq |
0.1ml |
EUR 400 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 488. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-A565 |
Stressmarq |
0.1ml |
EUR 400 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 565. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-A594 |
Stressmarq |
0.1ml |
EUR 400 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 594. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-A633 |
Stressmarq |
0.1ml |
EUR 400 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 633. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-A655 |
Stressmarq |
0.1ml |
EUR 400 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 655. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-A680 |
Stressmarq |
0.1ml |
EUR 400 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 680. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-A700 |
Stressmarq |
0.1ml |
EUR 400 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to ATTO 700. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-ALP |
Stressmarq |
0.1ml |
EUR 394 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Alkaline Phosphatase. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-APC |
Stressmarq |
0.1ml |
EUR 399 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to APC . |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-APCCY7 |
Stressmarq |
0.1ml |
EUR 471 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to APC/Cy7. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-BI |
Stressmarq |
0.1ml |
EUR 396 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Biotin. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-DY350 |
Stressmarq |
0.1ml |
EUR 475 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 350. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-DY405 |
Stressmarq |
0.1ml |
EUR 452 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 405. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-DY488 |
Stressmarq |
0.1ml |
EUR 432 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 488. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-DY594 |
Stressmarq |
0.1ml |
EUR 436 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 594. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-DY633 |
Stressmarq |
0.1ml |
EUR 426 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Dylight 633. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-FITC |
Stressmarq |
0.1ml |
EUR 392 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to FITC. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-HRP |
Stressmarq |
0.1ml |
EUR 388 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to HRP. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-P594 |
Stressmarq |
0.1ml |
EUR 407 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to PE/ATTO 594. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-PCP |
Stressmarq |
0.1ml |
EUR 399 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to PerCP. |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-RPE |
Stressmarq |
0.1ml |
EUR 397 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to RPE . |
Antibody for Human LATS1 (pSer909) |
SPC-1005D-STR |
Stressmarq |
0.1ml |
EUR 398 |
- LATS1 is a protein serine/threonine kinase that suppresses tumour progression by restricting proliferation and promoting apoptosis by activating the transcription of BAX, caspase 3 and p53. It can phosphorylate and inactivate the YAP1 oncoprotein and
- Show more
|
Description: A polyclonal antibody for LATS1 (pSer909) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser909 of human LATS1 (AA906-912). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This LATS1 (pSer909) antibody is conjugated to Streptavidin. |
Human LATS1(Serine/threonine-protein kinase LATS1) ELISA Kit |
EH9736 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Serine/threonine- protein kinase LATS1, LATS1 ELISA KIT |
ELI-36986h |
Lifescience Market |
96 Tests |
EUR 824 |
Mouse Serine/threonine- protein kinase LATS1, Lats1 ELISA KIT |
ELI-42693m |
Lifescience Market |
96 Tests |
EUR 865 |
Phospho-LATS1/2 (Ser909/872) Blocking Peptide |
AF8163-BP |
Affbiotech |
1mg |
EUR 195 |
Lats1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3825503 |
ABM |
1.0 ug DNA |
EUR 154 |
LATS1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1198203 |
ABM |
1.0 ug DNA |
EUR 154 |
Phospho-LATS1/LATS2 (Thr1079/1041) Antibody |
CSB-PA905508- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-LATS1/LATS2 (Thr1079/1041). Recognizes Phospho-LATS1/LATS2 (Thr1079/1041) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
Phospho-LATS1/LATS2 (Thr1079/1041) Antibody |
CSB-PA905508-100ul |
Cusabio |
100ul |
EUR 362 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
- Show more
|
Description: A polyclonal antibody against Phospho-LATS1/LATS2 (Thr1079/1041). Recognizes Phospho-LATS1/LATS2 (Thr1079/1041) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
Phospho-LATS1/LATS2 (T1079/1041) Antibody |
1-CSB-PA070231 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against Phospho-LATS1/LATS2 (T1079/1041). Recognizes Phospho-LATS1/LATS2 (T1079/1041) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/20000 |
Human LATS1 shRNA Plasmid |
20-abx956022 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LATS1/LATS2 Rabbit pAb |
A18286-100ul |
Abclonal |
100 ul |
EUR 308 |
LATS1/LATS2 Rabbit pAb |
A18286-200ul |
Abclonal |
200 ul |
EUR 459 |
LATS1/LATS2 Rabbit pAb |
A18286-20ul |
Abclonal |
20 ul |
EUR 183 |
LATS1/LATS2 Rabbit pAb |
A18286-50ul |
Abclonal |
50 ul |
EUR 223 |
Mouse LATS1 shRNA Plasmid |
20-abx971282 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Anti-ErbB 2/ERBB2 Antibody |
A00010-2 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-Bcl-2/BCL2 Antibody |
A00040-2 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-Angiopoietin-2/ANGPT2 Antibody |
A00370-2 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-EIF4A1/2/3 Antibody |
A03922-2 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-Fascin 2/FSCN2 Antibody |
A07840-2 |
BosterBio |
100ug/vial |
EUR 294 |
Large Tumor Suppressor Kinase 1 (LATS1) Antibody |
20-abx113445 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Large Tumor Suppressor Kinase 1 (LATS1) Antibody |
abx033135-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Large Tumor Suppressor Kinase 1 (LATS1) Antibody |
abx033135-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Large Tumor Suppressor Kinase 1 (LATS1) Antibody |
20-abx007804 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Large Tumor Suppressor Kinase 1 (LATS1) Antibody |
20-abx312862 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Large Tumor Suppressor Kinase 1 (lats1) Antibody |
abx216530-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Large Tumor Suppressor Kinase 1 (LATS1) Antibody |
abx234708-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Large Tumor Suppressor Kinase 1 (LATS1) Antibody |
20-abx210537 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-phospho-LATS1-S909/LATS2-S872 antibody |
STJ11101017 |
St John's Laboratory |
50 µl |
EUR 393 |
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. |
Anti-phospho-LATS1-T1079/LATS2-T1041 antibody |
STJ11101018 |
St John's Laboratory |
50 µl |
EUR 393 |
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. |
Anti-phospho-LATS1-S909/LATS2-S872 antibody |
STJ11101039 |
St John's Laboratory |
100 µl |
EUR 393 |
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. |
Anti-phospho-LATS1-T1079/LATS2-T1041 antibody |
STJ11101047 |
St John's Laboratory |
100 µl |
EUR 393 |
Description: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. |
Anti-COX2/Cyclooxygenase 2/PTGS2 Antibody |
A00084-2 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-beta 2 Microglobulin/B2m Antibody |
A00456-2 |
BosterBio |
100ug/vial |
EUR 294 |
Anti-VEGF Receptor 2/KDR Antibody |
A00901-2 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-Adiponectin Receptor 2 (mouse) Antibody |
A02218-2 |
BosterBio |
200ug |
EUR 498 |
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse. |
Anti-Anterior Gradient 2/AGR2 Antibody |
A02922-2 |
BosterBio |
100ug/vial |
EUR 334 |
Anti-p56Dok-2 (Ab-299) Antibody |
A07956-2 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal p56Dok-2 (Ab-299) Antibody. Validated in IF, IHC, WB and tested in Human. |
Anti-Bcl-2 Rabbit Monoclonal Antibody |
M00040-2 |
BosterBio |
100ug/vial |
EUR 397 |
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse. |
Anti-HIF-2-alpha/EPAS1 Antibody |
PA1129-2 |
BosterBio |
100ug/vial |
EUR 294 |
Phospho-LATS1 (Thr1079) Blocking Peptide |
AF7169-BP |
Affbiotech |
1mg |
EUR 195 |
Phospho-LATS1 (Ser909) Blocking Peptide |
AF7170-BP |
Affbiotech |
1mg |
EUR 195 |
Phospho-LATS1 (Tyr283) Blocking Peptide |
AF7171-BP |
Affbiotech |
1mg |
EUR 195 |
LATS1 ORF Vector (Human) (pORF) |
ORF005858 |
ABM |
1.0 ug DNA |
EUR 95 |
LATS1 ORF Vector (Human) (pORF) |
ORF005859 |
ABM |
1.0 ug DNA |
EUR 95 |
Lats1 ORF Vector (Mouse) (pORF) |
ORF048977 |
ABM |
1.0 ug DNA |
EUR 506 |
LATS1 ELISA Kit (Human) (OKEH07987) |
OKEH07987 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL |
Anti-Beta 2 Microglobulin Antibody (monoclonal, 2H10) |
M00456-2 |
BosterBio |
100ug/vial |
EUR 334 |
LATS1/2 antibody