LRP6 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
LRP6 Polyclonal Antibody |
ABP59148-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human LRP6 protein at amino acid sequence of 1420-1500
- Applications tips:
|
Description: A polyclonal antibody for detection of LRP6 from Human, Mouse. This LRP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRP6 protein at amino acid sequence of 1420-1500 |
LRP6 Polyclonal Antibody |
42243-100ul |
SAB |
100ul |
EUR 333 |
LRP6 Rabbit pAb |
A13324-100ul |
Abclonal |
100 ul |
EUR 308 |
LRP6 Rabbit pAb |
A13324-200ul |
Abclonal |
200 ul |
EUR 459 |
LRP6 Rabbit pAb |
A13324-20ul |
Abclonal |
20 ul |
EUR 183 |
LRP6 Rabbit pAb |
A13324-50ul |
Abclonal |
50 ul |
EUR 223 |
LRP6 Rabbit pAb |
A13678-100ul |
Abclonal |
100 ul |
EUR 308 |
LRP6 Rabbit pAb |
A13678-200ul |
Abclonal |
200 ul |
EUR 459 |
LRP6 Rabbit pAb |
A13678-20ul |
Abclonal |
20 ul |
EUR 183 |
LRP6 Rabbit pAb |
A13678-50ul |
Abclonal |
50 ul |
EUR 223 |
LRP6 Rabbit pAb |
A15070-100ul |
Abclonal |
100 ul |
EUR 308 |
LRP6 Rabbit pAb |
A15070-200ul |
Abclonal |
200 ul |
EUR 459 |
LRP6 Rabbit pAb |
A15070-20ul |
Abclonal |
20 ul |
EUR 183 |
LRP6 Rabbit pAb |
A15070-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal LRP6 Antibody (Internal) |
APS00034G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (Internal). This antibody is tested and proven to work in the following applications: |
Rabbit LRP6 ELISA Kit |
ERTL0286 |
Abclonal |
96Tests |
EUR 521 |
LRP6 antibody |
38724-100ul |
SAB |
100ul |
EUR 252 |
LRP6 Antibody |
43398-100ul |
SAB |
100ul |
EUR 252 |
LRP6 Antibody |
45043-100ul |
SAB |
100ul |
EUR 252 |
LRP6 Antibody |
45043-50ul |
SAB |
50ul |
EUR 187 |
LRP6 Antibody |
DF7837 |
Affbiotech |
200ul |
EUR 304 |
Description: LRP6 Antibody detects endogenous levels of total LRP6. |
LRP6 Antibody |
DF2995 |
Affbiotech |
200ul |
EUR 304 |
Description: LRP6 Antibody detects endogenous levels of total LRP6. |
LRP6 Antibody |
1-CSB-PA013102ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
LRP6 Antibody |
1-CSB-PA234397 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:40-1:200 |
Polyclonal LRP6 Antibody (internal region) |
APS00033G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (internal region). This antibody is tested and proven to work in the following applications: |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
DLR-LRP6-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids. |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
DLR-LRP6-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids. |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
RD-LRP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
RD-LRP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
RDR-LRP6-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit |
RDR-LRP6-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Polyclonal LRP6 Antibody (C-term T1546) |
APR14063G |
Leading Biology |
0.1ml |
EUR 528 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LRP6 (C-term T1546). This antibody is tested and proven to work in the following applications: |
LRP6 (Phospho-Thr1479) Polyclonal Conjugated Antibody |
C12661 |
SAB |
100ul |
EUR 397 |
LRP6 (Phospho-Ser1490) Polyclonal Conjugated Antibody |
C12809 |
SAB |
100ul |
EUR 397 |
LRP6 Conjugated Antibody |
C38724 |
SAB |
100ul |
EUR 397 |
LRP6 Conjugated Antibody |
C45043 |
SAB |
100ul |
EUR 397 |
LRP6 (pT1479) Antibody |
abx216611-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
LRP6 (pS1490) Antibody |
20-abx216612 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-LRP6 antibody |
STJ27887 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
Anti-LRP6 antibody |
STJ115287 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
Anti-LRP6 antibody |
STJ115288 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
Anti-LRP6 antibody |
STJ117264 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
Anti-LRP6 antibody |
STJ190146 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to LRP6 |
Anti-LRP6 antibody |
STJ115633 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined. |
LRP6 siRNA |
20-abx922854 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
LRP6 siRNA |
20-abx922855 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-LRP6 (Thr1479) Antibody |
AF8343 |
Affbiotech |
200ul |
EUR 376 |
Description: LRP6 (Phospho-Thr1479) Antibody detects endogenous levels of LRP6 only when phosphorylated at Thr1479. |
Phospho-LRP6 (Ser1490) Antibody |
AF8344 |
Affbiotech |
200ul |
EUR 376 |
Description: LRP6 (Phospho-Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490. |
Phospho-LRP6 (Ser1490) Antibody |
abx216613-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
LRP6 (Phospho-Thr1479) Antibody |
12661-100ul |
SAB |
100ul |
EUR 252 |
LRP6 (Phospho-Thr1479) Antibody |
12661-50ul |
SAB |
50ul |
EUR 187 |
LRP6 (Phospho-Ser1490) Antibody |
12809-100ul |
SAB |
100ul |
EUR 252 |
LRP6 (Phospho-Ser1490) Antibody |
12809-50ul |
SAB |
50ul |
EUR 187 |
Phospho-LRP6 (Ser1490) Antibody |
DF2994 |
Affbiotech |
200ul |
EUR 304 |
Description: Phospho-LRP6 (Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490. |
LRP6 cloning plasmid |
CSB-CL013102HU-10ug |
Cusabio |
10ug |
EUR 1882 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4842
- Sequence: atgggggccgtcctgaggagcctcctggcctgcagcttctgtgtgctcctgagagcggcccctttgttgctttatgcaaacagacgggacttgcgattggttgatgctacaaatggcaaagagaatgctacgattgtagttggaggcttggaggatgcagctgcggtggactttg
- Show more
|
Description: A cloning plasmid for the LRP6 gene. |
LRP6 Blocking Peptide |
DF7837-BP |
Affbiotech |
1mg |
EUR 195 |
LRP6 Blocking Peptide |
DF2995-BP |
Affbiotech |
1mg |
EUR 195 |
Low-density lipoprotein receptor-related protein 6 (LRP6) polyclonal antibody |
ABP-PAB-10779 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Cell Surface Molecules / GPCRs
- Brand:
|
Human LRP6 ELISA Kit |
EHL0286 |
Abclonal |
96Tests |
EUR 521 |
Goat LRP6 ELISA Kit |
EGTL0286 |
Abclonal |
96Tests |
EUR 521 |
Bovine LRP6 ELISA Kit |
EBL0286 |
Abclonal |
96Tests |
EUR 521 |
Chicken LRP6 ELISA Kit |
ECKL0286 |
Abclonal |
96Tests |
EUR 521 |
Canine LRP6 ELISA Kit |
ECL0286 |
Abclonal |
96Tests |
EUR 521 |
Anserini LRP6 ELISA Kit |
EAL0286 |
Abclonal |
96Tests |
EUR 521 |
Porcine LRP6 ELISA Kit |
EPL0286 |
Abclonal |
96Tests |
EUR 521 |
Rat LRP6 ELISA Kit |
ERL0286 |
Abclonal |
96Tests |
EUR 521 |
Sheep LRP6 ELISA Kit |
ESL0286 |
Abclonal |
96Tests |
EUR 521 |
Monkey LRP6 ELISA Kit |
EMKL0286 |
Abclonal |
96Tests |
EUR 521 |
Mouse LRP6 ELISA Kit |
EML0286 |
Abclonal |
96Tests |
EUR 521 |
Human LRP6 shRNA Plasmid |
20-abx952731 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
LRP6 Rabbit Polyclonal Antibody