LRP6 Rabbit Polyclonal Antibody

LRP6 Rabbit Polyclonal Antibody

To Order:

LRP6 Polyclonal Antibody

ABP59148-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human LRP6 protein at amino acid sequence of 1420-1500
  • Applications tips:
Description: A polyclonal antibody for detection of LRP6 from Human, Mouse. This LRP6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LRP6 protein at amino acid sequence of 1420-1500

LRP6 Polyclonal Antibody

42243-100ul 100ul
EUR 333

LRP6 Rabbit pAb

A13324-100ul 100 ul
EUR 308

LRP6 Rabbit pAb

A13324-200ul 200 ul
EUR 459

LRP6 Rabbit pAb

A13324-20ul 20 ul
EUR 183

LRP6 Rabbit pAb

A13324-50ul 50 ul
EUR 223

LRP6 Rabbit pAb

A13678-100ul 100 ul
EUR 308

LRP6 Rabbit pAb

A13678-200ul 200 ul
EUR 459

LRP6 Rabbit pAb

A13678-20ul 20 ul
EUR 183

LRP6 Rabbit pAb

A13678-50ul 50 ul
EUR 223

LRP6 Rabbit pAb

A15070-100ul 100 ul
EUR 308

LRP6 Rabbit pAb

A15070-200ul 200 ul
EUR 459

LRP6 Rabbit pAb

A15070-20ul 20 ul
EUR 183

LRP6 Rabbit pAb

A15070-50ul 50 ul
EUR 223

Polyclonal LRP6 Antibody (Internal)

APS00034G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (Internal). This antibody is tested and proven to work in the following applications:

Rabbit Anti-LRP6 Monoclonal Antibody

CAB-3806RH 100 ul
EUR 840

Rabbit LRP6 ELISA Kit

ERTL0286 96Tests
EUR 521

LRP6 Antibody

ABD2995 100 ug
EUR 438

LRP6 Antibody

ABD7837 100 ug
EUR 438

LRP6 Antibody

ABD7954 100 ug
EUR 438

LRP6 Antibody

ABD8165 100 ug
EUR 438

LRP6 antibody

38724-100ul 100ul
EUR 252

LRP6 Antibody

43398-100ul 100ul
EUR 252

LRP6 Antibody

45043-100ul 100ul
EUR 252

LRP6 Antibody

45043-50ul 50ul
EUR 187

LRP6 Antibody

DF7837 200ul
EUR 304
Description: LRP6 Antibody detects endogenous levels of total LRP6.

LRP6 Antibody

DF2995 200ul
EUR 304
Description: LRP6 Antibody detects endogenous levels of total LRP6.

LRP6 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LRP6 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LRP6. Recognizes LRP6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:40-1:200

Polyclonal LRP6 Antibody (internal region)

APS00033G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LRP6 (internal region). This antibody is tested and proven to work in the following applications:

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

DLR-LRP6-Hu-48T 48T
EUR 517
  • Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids.

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

DLR-LRP6-Hu-96T 96T
EUR 673
  • Should the Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) in samples from tissue homogenates or other biological fluids.

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

RD-LRP6-Hu-48Tests 48 Tests
EUR 521

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

RD-LRP6-Hu-96Tests 96 Tests
EUR 723

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

RDR-LRP6-Hu-48Tests 48 Tests
EUR 544

Human Low Density Lipoprotein Receptor Related Protein 6 (LRP6) ELISA Kit

RDR-LRP6-Hu-96Tests 96 Tests
EUR 756

Polyclonal LRP6 Antibody (C-term T1546)

APR14063G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LRP6 (C-term T1546). This antibody is tested and proven to work in the following applications:

LRP6 (Phospho-Thr1479) Polyclonal Conjugated Antibody

C12661 100ul
EUR 397

LRP6 (Phospho-Ser1490) Polyclonal Conjugated Antibody

C12809 100ul
EUR 397

LRP6 Conjugated Antibody

C38724 100ul
EUR 397

LRP6 Conjugated Antibody

C45043 100ul
EUR 397

LRP6 (pT1479) Antibody

abx216611-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

LRP6 (pS1490) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-LRP6 antibody

STJ70616 100 µg
EUR 359

Anti-LRP6 antibody

STJ27887 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody

STJ115287 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody

STJ115288 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody

STJ117264 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.

Anti-LRP6 antibody

STJ190146 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to LRP6

Anti-LRP6 antibody

STJ115633 100 µl
EUR 277
Description: This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Phospho-LRP6 (Thr1479) Antibody

AF8343 200ul
EUR 376
Description: LRP6 (Phospho-Thr1479) Antibody detects endogenous levels of LRP6 only when phosphorylated at Thr1479.

Phospho-LRP6 (Ser1490) Antibody

AF8344 200ul
EUR 376
Description: LRP6 (Phospho-Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490.

LRP6 (Phospho- Thr1479) Antibody

ABF8343 100 ug
EUR 438

LRP6 (Phospho- Ser1490) Antibody

ABF8344 100 ug
EUR 438

Phospho-LRP6 (Ser1490) Antibody

abx216613-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Phospho- LRP6 (Ser1490) Antibody

ABD2994 100 ug
EUR 438

LRP6 (Phospho-Thr1479) Antibody

12661-100ul 100ul
EUR 252

LRP6 (Phospho-Thr1479) Antibody

12661-50ul 50ul
EUR 187

LRP6 (Phospho-Ser1490) Antibody

12809-100ul 100ul
EUR 252

LRP6 (Phospho-Ser1490) Antibody

12809-50ul 50ul
EUR 187

Phospho-LRP6 (Ser1490) Antibody

DF2994 200ul
EUR 304
Description: Phospho-LRP6 (Ser1490) Antibody detects endogenous levels of LRP6 only when phosphorylated at Ser1490.

LRP6 cloning plasmid

CSB-CL013102HU-10ug 10ug
EUR 1882
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4842
  • Sequence: atgggggccgtcctgaggagcctcctggcctgcagcttctgtgtgctcctgagagcggcccctttgttgctttatgcaaacagacgggacttgcgattggttgatgctacaaatggcaaagagaatgctacgattgtagttggaggcttggaggatgcagctgcggtggactttg
  • Show more
Description: A cloning plasmid for the LRP6 gene.

LRP6 Blocking Peptide

DF7837-BP 1mg
EUR 195

LRP6 Blocking Peptide

DF2995-BP 1mg
EUR 195

Low-density lipoprotein receptor-related protein 6 (LRP6) polyclonal antibody

ABP-PAB-10779 100 ug Ask for price
    • Product line: Cell Surface Molecules / GPCRs
    • Brand:

Anti-Human LRP6 Antibody, phospho S149

CABT-28228RH 100 ul
EUR 710

Human LRP6 ELISA Kit

EHL0286 96Tests
EUR 521

Human LRP6 ELISA Kit

ELA-E1010h 96 Tests
EUR 824


EGTL0286 96Tests
EUR 521

Bovine LRP6 ELISA Kit

EBL0286 96Tests
EUR 521

Chicken LRP6 ELISA Kit

ECKL0286 96Tests
EUR 521

Canine LRP6 ELISA Kit

ECL0286 96Tests
EUR 521

Anserini LRP6 ELISA Kit

EAL0286 96Tests
EUR 521


ELI-03231h 96 Tests
EUR 824

Mouse Lrp6 ELISA KIT

ELI-03232m 96 Tests
EUR 865


EF001894 96 Tests
EUR 689

Porcine LRP6 ELISA Kit

EPL0286 96Tests
EUR 521


ERL0286 96Tests
EUR 521

Sheep LRP6 ELISA Kit

ESL0286 96Tests
EUR 521

Monkey LRP6 ELISA Kit

EMKL0286 96Tests
EUR 521

Mouse LRP6 ELISA Kit

EML0286 96Tests
EUR 521

Human LRP6 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

LRP6 Rabbit Polyclonal Antibody

Back To Top