MAP4 Rabbit Polyclonal Antibody

MAP4 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

MAP4 Polyclonal Antibody
ES8897-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MAP4 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAP4 Rabbit pAb
A5906-100ul	Abclonal	100 ul	EUR 308

MAP4 Rabbit pAb
A5906-200ul	Abclonal	200 ul	EUR 459

MAP4 Rabbit pAb
A5906-20ul	Abclonal	20 ul	EUR 183

MAP4 Rabbit pAb
A5906-50ul	Abclonal	50 ul	EUR 223

MAP4 Rabbit pAb
A17421-100ul	Abclonal	100 ul	Ask for price

MAP4 Rabbit pAb
A17421-200ul	Abclonal	200 ul	Ask for price

MAP4 Rabbit pAb
A17421-20ul	Abclonal	20 ul	Ask for price

MAP4 Rabbit pAb
A17421-50ul	Abclonal	50 ul	EUR 384

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit
DLR-MAP4-Hu-48T	DL Develop	48T	EUR 498
Should the Human Microtubule Associated Protein 4 (MAP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microtubule Associated Protein 4 (MAP4) in samples from tissue homogenates or other biological fluids.

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit
DLR-MAP4-Hu-96T	DL Develop	96T	EUR 647
Should the Human Microtubule Associated Protein 4 (MAP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Microtubule Associated Protein 4 (MAP4) in samples from tissue homogenates or other biological fluids.

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit
DLR-MAP4-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Microtubule Associated Protein 4 (MAP4) in samples from tissue homogenates or other biological fluids.

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit
DLR-MAP4-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Microtubule Associated Protein 4 (MAP4) in samples from tissue homogenates or other biological fluids.

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit
RDR-MAP4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit
RDR-MAP4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit
RDR-MAP4-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit
RDR-MAP4-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit
RD-MAP4-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Microtubule Associated Protein 4 (MAP4) ELISA Kit
RD-MAP4-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit
RD-MAP4-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Microtubule Associated Protein 4 (MAP4) ELISA Kit
RD-MAP4-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

MAP4 antibody
70R-18393	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MAP4 antibody

MAP4 antibody
70R-10032	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal MAP4 antibody

MAP4 Antibody
35949-100ul	SAB	100ul	EUR 252

MAP4 Antibody
1-CSB-PA256025	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

MAP4 Antibody
1-CSB-PA265957	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

MAP4 antibody
70R-36731	Fitzgerald	100 ug	EUR 327
Description: Rabbit Polyclonal MAP4 antibody

MAP4 Antibody
1-CSB-PA013435GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MAP4 Antibody
1-CSB-PA013435LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MAP4 Antibody
1-CSB-PA010006	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

MAP4
B6414-10	ApexBio	10 mg	EUR 383

MAP4
B6414-50	ApexBio	50 mg	EUR 1455

MAP4 (Phospho-Ser696) Polyclonal Conjugated Antibody
C12448	SAB	100ul	EUR 397

MAP4 (pS696) Antibody
abx216702-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

MAP4 Conjugated Antibody
C35949	SAB	100ul	EUR 397

anti- MAP4 antibody
FNab04979	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:2000 IP: 1:500-1:5000 IHC: 1:50-1:500 Immunogen: microtubule-associated protein 4 Uniprot ID: P27816 Gene ID: 4134 Research Area: cancer, Neuroscience, Metabolism, Signal Transduction
Description: Antibody raised against MAP4

Anti-MAP4 antibody
PAab04979	Lifescience Market	100 ug	EUR 355

Anti-MAP4 antibody
STJ116286	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-MAP4 antibody
STJ119542	St John's Laboratory	50 µl	EUR 393
Description: The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-MAP4 antibody
STJ99615	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to MAP4.

Map4/ Rat Map4 ELISA Kit
ELI-23697r	Lifescience Market	96 Tests	EUR 886

MAP4 siRNA
20-abx903140	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAP4 siRNA
20-abx923474	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAP4 siRNA
20-abx923475	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAP4 (Phospho-Ser696) Antibody
12448-100ul	SAB	100ul	EUR 252

MAP4 (Phospho-Ser696) Antibody
12448-50ul	SAB	50ul	EUR 187

MAP4 Antibody, HRP conjugated
1-CSB-PA013435LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAP4 Antibody, FITC conjugated
1-CSB-PA013435LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAP4 Antibody, Biotin conjugated
1-CSB-PA013435LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAP4. Recognizes MAP4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-MAP4 (S696) Antibody
1-CSB-PA009999	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-MAP4 (S696). Recognizes Phospho-MAP4 (S696) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

Phospho-MAP4 (Ser696) Antibody
AF8075	Affbiotech	200ul	EUR 376
Description: MAP4 (Phospho-Ser696) Antibody detects endogenous levels of MAP4 only when phosphorylated at Ser696.

MAP4 (Phospho- Ser696) Antibody
ABF8075	Lifescience Market	100 ug	EUR 438

pCT-MAP4-GFP (pCMV, Microtubules, MAP4 Tag)
CYTO112-PA-1	SBI	10 ug	EUR 684
Category: Bioluminescent Imaging

pCT-MAP4-GFP (pCMV, Microtubules, MAP4 Tag)
CYTO112-VA-1	SBI	>2x10^6 IFUs	EUR 781
Category: Bioluminescent Imaging

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse)
4-PAB319Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Thr882~Glu1062) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4)

MAP4 Blocking Peptide
33R-5085	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAP4 antibody, catalog no. 70R-10032

MAP4 cloning plasmid
CSB-CL013435HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2940 Sequence: atggctgacctcagtcttgcagatgcattaacagaaccatctccagacattgagggagagataaagcgggacttcattgccacactagaggcagaggcctttgatgatgttgtgggagaaactgttggaaaaacagactatattcctctcctggatgttgatgagaaaaccggga Show more
Description: A cloning plasmid for the MAP4 gene.

pSV40- Map4- m
PVT11650	Lifescience Market	2 ug	EUR 273

Anti-MAP4 (7C9)
YF-MA14125	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to MAP4

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), APC
4-PAB319Mu01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Thr882~Glu1062) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), Biotinylated
4-PAB319Mu01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Thr882~Glu1062) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Biotin.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), Cy3
4-PAB319Mu01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Thr882~Glu1062) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Cy3.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), FITC
4-PAB319Mu01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Thr882~Glu1062) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with FITC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), HRP
4-PAB319Mu01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Thr882~Glu1062) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with HRP.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), PE
4-PAB319Mu01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Thr882~Glu1062) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with PE.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat)
4-PAB319Ra01	Cloud-Clone	EUR 251.00 EUR 2589.00 EUR 643.00 EUR 317.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Ala2~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4)

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx113747	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx124167	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx129317	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx130283	Abbexa	EUR 439.00 EUR 133.00 EUR 1247.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx130470	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx173571	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx173572	Abbexa	EUR 871.00 EUR 453.00	1 mg 200 ug
Please enquire.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx339167	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx339168	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody
abx234979-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx326783	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody
20-abx302221	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig)
4-PAB319Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Met243~Val549) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4)

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Mouse), APC-Cy7
4-PAB319Mu01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Thr882~Glu1062) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC-Cy7.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), APC
4-PAB319Ra01-APC	Cloud-Clone	EUR 352.00 EUR 3383.00 EUR 939.00 EUR 450.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Ala2~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAB319Ra01-Biotin	Cloud-Clone	EUR 316.00 EUR 2539.00 EUR 747.00 EUR 388.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Ala2~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Biotin.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), Cy3
4-PAB319Ra01-Cy3	Cloud-Clone	EUR 428.00 EUR 4469.00 EUR 1211.00 EUR 559.00 EUR 255.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Ala2~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Cy3.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), FITC
4-PAB319Ra01-FITC	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Ala2~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with FITC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), HRP
4-PAB319Ra01-HRP	Cloud-Clone	EUR 322.00 EUR 2948.00 EUR 830.00 EUR 407.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Ala2~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with HRP.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), PE
4-PAB319Ra01-PE	Cloud-Clone	EUR 302.00 EUR 2726.00 EUR 771.00 EUR 380.00 EUR 198.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Ala2~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with PE.

MAP4 ELISA KIT|Human
EF010818	Lifescience Market	96 Tests	EUR 689

Rat MAP4 shRNA Plasmid
20-abx990686	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MAP4 shRNA Plasmid
20-abx971604	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MAP4 shRNA Plasmid
20-abx952809	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), APC
4-PAB319Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Met243~Val549) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), Biotinylated
4-PAB319Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Met243~Val549) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Biotin.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), Cy3
4-PAB319Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Met243~Val549) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with Cy3.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), FITC
4-PAB319Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Met243~Val549) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with FITC.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), HRP
4-PAB319Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Met243~Val549) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with HRP.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), PE
4-PAB319Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Met243~Val549) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with PE.

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAB319Ra01-APC-Cy7	Cloud-Clone	EUR 585.00 EUR 6646.00 EUR 1759.00 EUR 781.00 EUR 326.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Ala2~Asp250) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC-Cy7.

Microtubule Associated Protein 4 (MAP4) Antibody (HRP)
20-abx315305	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody (FITC)
20-abx315306	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Microtubule Associated Protein 4 (MAP4) Antibody (Biotin)
20-abx315307	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Phospho-MAP4 (Ser696) Blocking Peptide
AF8075-BP	Affbiotech	1mg	EUR 195

Map4 ORF Vector (Rat) (pORF)
ORF070253	ABM	1.0 ug DNA	EUR 506

MAP4 ORF Vector (Human) (pORF)
ORF006254	ABM	1.0 ug DNA	EUR 95

MAP4 ELISA Kit (Human) (OKCD00829)
OKCD00829	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Non-neuronal microtubule-associated protein. Promotes microtubule assembly.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.11"Ser787 in the proline-rich region of human MAP4 is a critical phosphorylation site that reduces its activity to promote tubulin polymerization."_x005F_x005F_x000D_Kitazawa H., Iida J., Uchida A., Haino-Fukushima K., Itoh T.J., Hotani H., Ookata K., Murofushi H., Bulinski J.C., Kishimoto T., Hisanaga S._x005F_x005F_x000D_Cell Struct. Funct. 25:33-39(2000) [PubMed] [Europe PMC] [Abstract]Cited for: PHOSPHORYLATION AT SER-696 AND SER-787, FUNCTION, MUTAGENESIS OF SER-696 AND SER-787. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.101 ng/mL

MAP4 ELISA Kit (Rat) (OKCD00830)
OKCD00830	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Non-neuronal microtubule-associated protein. Promotes microtubule assembly (By similarity).By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.123 ng/mL

Microtubule Associated Protein 4 (MAP4) Polyclonal Antibody (Human, Rat, Pig), APC-Cy7
4-PAB319Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MAP4 (Met243~Val549) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat, Pig Microtubule Associated Protein 4 (MAP4). This antibody is labeled with APC-Cy7.

Map4 sgRNA CRISPR Lentivector set (Rat)
K6337501	ABM	3 x 1.0 ug	EUR 339

MAP4 sgRNA CRISPR Lentivector set (Human)
K1264701	ABM	3 x 1.0 ug	EUR 339

Recombinant Microtubule Associated Protein 4 (MAP4)
4-RPB319Hu01	Cloud-Clone	EUR 462.88 EUR 227.00 EUR 1460.80 EUR 553.60 EUR 1007.20 EUR 373.00 EUR 3502.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P27816 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 63.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Microtubule Associated Protein 4 expressed in: E.coli

Recombinant Microtubule Associated Protein 4 (MAP4)
4-RPB319Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P27546 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.3kDa Isoelectric Point: 10.2
Description: Recombinant Mouse Microtubule Associated Protein 4 expressed in: E.coli

Recombinant Microtubule Associated Protein 4 (MAP4)
4-RPB319Ra01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5M7W5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.7kDa Isoelectric Point: 4.2
Description: Recombinant Rat Microtubule Associated Protein 4 expressed in: E.coli

Microtubule Associated Protein 4 Phospho-Ser696 (MAP4 pS696) Antibody
20-abx326784	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Mouse Microtubule Associated Protein 4 (MAP4) Protein
20-abx166090	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Microtubule Associated Protein 4 (MAP4) Protein
20-abx167914	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Microtubule Associated Protein 4 (MAP4) Protein
20-abx168694	Abbexa	EUR 648.00 EUR 272.00 EUR 1970.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Map4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6337502	ABM	1.0 ug DNA	EUR 154

Map4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6337503	ABM	1.0 ug DNA	EUR 154

Map4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6337504	ABM	1.0 ug DNA	EUR 154

MAP4 sgRNA CRISPR Lentivector (Human) (Target 1)
K1264702	ABM	1.0 ug DNA	EUR 154

MAP4 sgRNA CRISPR Lentivector (Human) (Target 2)
K1264703	ABM	1.0 ug DNA	EUR 154

MAP4 sgRNA CRISPR Lentivector (Human) (Target 3)
K1264704	ABM	1.0 ug DNA	EUR 154

MAP4 Protein Vector (Human) (pPB-C-His)
PV025013	ABM	500 ng	EUR 329

MAP4 Protein Vector (Human) (pPB-N-His)
PV025014	ABM	500 ng	EUR 329

MAP4 Protein Vector (Human) (pPM-C-HA)
PV025015	ABM	500 ng	EUR 329

MAP4 Protein Vector (Human) (pPM-C-His)
PV025016	ABM	500 ng	EUR 329

MAP4 Protein Vector (Rat) (pPB-C-His)
PV281010	ABM	500 ng	EUR 1191

MAP4 Protein Vector (Rat) (pPB-N-His)
PV281011	ABM	500 ng	EUR 1191

MAP4 Protein Vector (Rat) (pPM-C-HA)
PV281012	ABM	500 ng	EUR 1191

MAP4 Protein Vector (Rat) (pPM-C-His)
PV281013	ABM	500 ng	EUR 1191

Map4 3'UTR Luciferase Stable Cell Line
TU212836	ABM	1.0 ml	Ask for price

Map4 3'UTR GFP Stable Cell Line
TU262836	ABM	1.0 ml	Ask for price

MAP4 3'UTR GFP Stable Cell Line
TU062963	ABM	1.0 ml	EUR 2333

MAP4 3'UTR Luciferase Stable Cell Line
TU012963	ABM	1.0 ml	EUR 2333

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

AmCyan Rabbit Polyclonal Antibody
38086-50ul	SAB	50ul	EUR 187

EBFP Rabbit Polyclonal Antibody
38087-100ul	SAB	100ul	EUR 252

EBFP Rabbit Polyclonal Antibody
38087-50ul	SAB	50ul	EUR 187

Vimentin Rabbit Polyclonal Antibody
38104-100ul	SAB	100ul	EUR 252

Vimentin Rabbit Polyclonal Antibody
38104-50ul	SAB	50ul	EUR 187

LDHD Rabbit Polyclonal Antibody
38105-100ul	SAB	100ul	EUR 252

LDHD Rabbit Polyclonal Antibody
38105-50ul	SAB	50ul	EUR 187

GAPDH Rabbit Polyclonal Antibody
A01021-005ml	Abbkine	0.05ml	EUR 147
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml	Abbkine	0.2ml	EUR 332
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody
A01021-02ml5	Abbkine	0.2ml×5	EUR 920
Immunogen information: Recombinant Protein Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody
A53073	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody
ABP57458-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody
ABP57458-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Recombinant Protein of Met of MET Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody
ABP57460-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody
ABP57460-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Recombinant Protein of VEGF of VEGFA Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

MAP4 Rabbit Polyclonal Antibody