MAST1 Rabbit Polyclonal Antibody

MAST1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

MAST1 Polyclonal Antibody

ES9107-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MAST1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MAST1 antibody

70R-18419 50 ul
EUR 435
Description: Rabbit polyclonal MAST1 antibody

MAST1 Antibody

45569-100ul 100ul
EUR 252

MAST1 Antibody

45569-50ul 50ul
EUR 187

MAST1 Antibody

1-CSB-PA897529LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MAST1 Antibody

DF8892 200ul
EUR 304
Description: MAST1 Antibody detects endogenous levels of total MAST1.

MAST1 Antibody

1-CSB-PA013511GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MAST1 Antibody

ABD8892 100 ug
EUR 438

Polyclonal Mouse Mast1 Antibody (C-term)

APR17430G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Mast1 (C-term). This antibody is tested and proven to work in the following applications:

Mast1/ Rat Mast1 ELISA Kit

ELI-16331r 96 Tests
EUR 886

Mouse Mast1 Antibody

abx034670-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Mast1 Antibody

abx034670-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MAST1 Conjugated Antibody

C45569 100ul
EUR 397

anti- MAST1 antibody

FNab05024 100µg
EUR 505.25
  • Immunogen: microtubule associated serine/threonine kinase 1
  • Uniprot ID: Q9Y2H9
  • Gene ID: 22983
  • Research Area: Metabolism
Description: Antibody raised against MAST1

Anti-MAST1 antibody

PAab05024 100 ug
EUR 355

Anti-MAST1 antibody

STJ190265 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MAST1

MAST1 siRNA

20-abx903168
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAST1 siRNA

20-abx923602
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAST1 siRNA

20-abx923603
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAST1 Antibody, HRP conjugated

1-CSB-PA897529LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAST1 Antibody, FITC conjugated

1-CSB-PA897529LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAST1 Antibody, Biotin conjugated

1-CSB-PA897529LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAST1. Recognizes MAST1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MAST1 cloning plasmid

CSB-CL897529HU-10ug 10ug
EUR 1141
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3192
  • Sequence: atgggtcacatcaagctcacagatttcggcctctccaagatggggctcatgagcctcaccaccaacttatatgaaggccacatcgagaaggacgcccgagagttcctggacaaacaggtgtgtgggaccccagagtacatcgcgcccgaggtcatcctgcgtcaaggctacggca
  • Show more
Description: A cloning plasmid for the MAST1 gene.

MAST1 Blocking Peptide

DF8892-BP 1mg
EUR 195

Human MAST1 ELISA KIT

ELI-08438h 96 Tests
EUR 824

MAST1 ELISA KIT|Human

EF010848 96 Tests
EUR 689

Rat MAST1 shRNA Plasmid

20-abx990005
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MAST1 shRNA Plasmid

20-abx974826
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human MAST1 shRNA Plasmid

20-abx957907
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Mast1 ELISA KIT

ELI-39128m 96 Tests
EUR 865

MAST1 ORF Vector (Rat) (pORF)

ORF070313 1.0 ug DNA
EUR 2080

MAST1 Rabbit Polyclonal Antibody

Back To Top