MESP2 Rabbit Polyclonal Antibody

MESP2 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

MESP2 Polyclonal Antibody

ES9051-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MESP2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MESP2 antibody

20R-1126 100 ug
EUR 377
Description: Rabbit polyclonal MESP2 antibody

MESP2 Antibody

1-CSB-PA613150ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MESP2. Recognizes MESP2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

MESP2 Antibody

BF0003 200ul
EUR 376
Description: MESP2 antibody detects endogenous levels of total MESP2.

Anti-MESP2 antibody

PAab05131 100 ug
EUR 412

Anti-MESP2 antibody

STJ190209 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MESP2

MESP2 siRNA

20-abx923947
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MESP2 siRNA

20-abx923948
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MESP2 Blocking Peptide

33R-8337 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MESP2 antibody, catalog no. 20R-1126

MESP2 Blocking Peptide

20-abx161160
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MESP2 Blocking Peptide

BF0003-BP 1mg
EUR 195

MESP2 cloning plasmid

CSB-CL613150HU-10ug 10ug
EUR 440
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1182
  • Sequence: ATGGCCCAGTCGCCTCCTCCGCAGAGCCTCCTCGGCCACGACCACTGGATCTTCGCCCAGGGCTGGGGCTGGGCCGGCCACTGGGACTCCACGTCCCCGGCCTCCTCCTCCGATTCGTCGGGTTCGTGCCCCTGCGACGGCGCCCGCGGACTCCCGCAGCCACAGCCTCCGAGCT
  • Show more
Description: A cloning plasmid for the MESP2 gene.

Anti-Mesp2 (1C8)

YF-MA19909 100 ug
EUR 363
Description: Mouse monoclonal to Mesp2

Anti-Mesp2 (1E11)

YF-MA19910 100 ug
EUR 363
Description: Mouse monoclonal to Mesp2

Monoclonal MESP2 Antibody, Clone: 1B3F9

APR08421G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human MESP2. The antibodies are raised in Mouse and are from clone 1B3F9. This antibody is applicable in WB, E

MESP2 ELISA KIT|Human

EF000751 96 Tests
EUR 689

Human MESP2 shRNA Plasmid

20-abx965449
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MESP2 shRNA Plasmid

20-abx971498
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MESP2 Recombinant Protein (Human)

RP041305 100 ug Ask for price

MESP2 Recombinant Protein (Mouse)

RP150248 100 ug Ask for price

MESP2 Recombinant Protein (Rat)

RP211406 100 ug Ask for price

Mesp2 ORF Vector (Rat) (pORF)

ORF070470 1.0 ug DNA
EUR 506

MESP2 ORF Vector (Human) (pORF)

ORF013769 1.0 ug DNA
EUR 354

Mesp2 ORF Vector (Mouse) (pORF)

ORF050084 1.0 ug DNA
EUR 506

Mesoderm Posterior BHLH Transcription Factor 2 (MESP2) Antibody

20-abx121160
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Mesoderm Posterior BHLH Transcription Factor 2 (MESP2) Antibody

abx011989-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Mesoderm Posterior BHLH Transcription Factor 2 (MESP2) Antibody

abx235131-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Mesoderm Posterior BHLH Transcription Factor 2 (MESP2) Antibody

20-abx322076
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mesp2 sgRNA CRISPR Lentivector set (Rat)

K6441601 3 x 1.0 ug
EUR 339

MESP2 sgRNA CRISPR Lentivector set (Human)

K1291901 3 x 1.0 ug
EUR 339

Mesp2 sgRNA CRISPR Lentivector set (Mouse)

K3648701 3 x 1.0 ug
EUR 339

Mesp2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6441602 1.0 ug DNA
EUR 154

Mesp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6441603 1.0 ug DNA
EUR 154

Mesp2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6441604 1.0 ug DNA
EUR 154

MESP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1291902 1.0 ug DNA
EUR 154

MESP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1291903 1.0 ug DNA
EUR 154

MESP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1291904 1.0 ug DNA
EUR 154

Mesp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3648702 1.0 ug DNA
EUR 154

Mesp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3648703 1.0 ug DNA
EUR 154

Mesp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3648704 1.0 ug DNA
EUR 154

MESP2 Protein Vector (Mouse) (pPB-C-His)

PV200334 500 ng
EUR 603

MESP2 Protein Vector (Mouse) (pPB-N-His)

PV200335 500 ng
EUR 603

MESP2 Protein Vector (Mouse) (pPM-C-HA)

PV200336 500 ng
EUR 603

MESP2 Protein Vector (Mouse) (pPM-C-His)

PV200337 500 ng
EUR 603

MESP2 Protein Vector (Rat) (pPB-C-His)

PV281878 500 ng
EUR 603

MESP2 Protein Vector (Rat) (pPB-N-His)

PV281879 500 ng
EUR 603

MESP2 Protein Vector (Rat) (pPM-C-HA)

PV281880 500 ng
EUR 603

MESP2 Protein Vector (Rat) (pPM-C-His)

PV281881 500 ng
EUR 603

MESP2 Protein Vector (Human) (pPB-C-His)

PV055073 500 ng
EUR 481

MESP2 Protein Vector (Human) (pPB-N-His)

PV055074 500 ng
EUR 481

MESP2 Protein Vector (Human) (pPM-C-HA)

PV055075 500 ng
EUR 481

MESP2 Protein Vector (Human) (pPM-C-His)

PV055076 500 ng
EUR 481

Mesp2 3'UTR Luciferase Stable Cell Line

TU113100 1.0 ml Ask for price

Mesp2 3'UTR GFP Stable Cell Line

TU163100 1.0 ml Ask for price

Mesp2 3'UTR Luciferase Stable Cell Line

TU213070 1.0 ml Ask for price

Mesp2 3'UTR GFP Stable Cell Line

TU263070 1.0 ml Ask for price

MESP2 3'UTR GFP Stable Cell Line

TU063247 1.0 ml
EUR 1394

MESP2 3'UTR Luciferase Stable Cell Line

TU013247 1.0 ml
EUR 1394

Human Mesoderm posterior protein 2, MESP2 ELISA KIT

ELI-43001h 96 Tests
EUR 824

Mouse Mesoderm posterior protein 2, Mesp2 ELISA KIT

ELI-36442m 96 Tests
EUR 865

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

AmCyan Rabbit Polyclonal Antibody

38086-100ul 100ul
EUR 252

AmCyan Rabbit Polyclonal Antibody

38086-50ul 50ul
EUR 187

EBFP Rabbit Polyclonal Antibody

38087-100ul 100ul
EUR 252

EBFP Rabbit Polyclonal Antibody

38087-50ul 50ul
EUR 187

Vimentin Rabbit Polyclonal Antibody

38104-100ul 100ul
EUR 252

Vimentin Rabbit Polyclonal Antibody

38104-50ul 50ul
EUR 187

LDHD Rabbit Polyclonal Antibody

38105-100ul 100ul
EUR 252

LDHD Rabbit Polyclonal Antibody

38105-50ul 50ul
EUR 187

GAPDH Rabbit Polyclonal Antibody

A01021-005ml 0.05ml
EUR 147
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml 0.2ml
EUR 332
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

GAPDH Rabbit Polyclonal Antibody

A01021-02ml5 0.2ml×5
EUR 920
  • Immunogen information: Recombinant Protein
  • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
  • Show more
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

Rabbit Hemoglobin Polyclonal Antibody

A53073 100 µg
EUR 570.55
Description: The best epigenetics products

Met Rabbit Polyclonal Antibody

ABP57458-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

Met Rabbit Polyclonal Antibody

ABP57458-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of Met of MET
  • Applications tips:
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

VEGF Rabbit Polyclonal Antibody

ABP57460-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

VEGF Rabbit Polyclonal Antibody

ABP57460-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of VEGF of VEGFA
  • Applications tips:
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

CD10 Rabbit Polyclonal Antibody

ABP57461-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

CD10 Rabbit Polyclonal Antibody

ABP57461-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of CD10 of MME
  • Applications tips:
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

NM23A Rabbit Polyclonal Antibody

ABP57462-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of NM23A of NME1
  • Applications tips:
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

MESP2 Rabbit Polyclonal Antibody

Back To Top