MIA Rabbit Polyclonal Antibody

MIA Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

MIA Polyclonal Antibody

ES8773-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MIA from Human. This antibody is tested and validated for IHC, WB, ELISA

MIA Polyclonal Antibody

ES8773-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MIA from Human. This antibody is tested and validated for IHC, WB, ELISA

MIA Polyclonal Antibody

ABP59271-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131
  • Applications tips:
Description: A polyclonal antibody for detection of MIA from Human. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131

MIA Polyclonal Antibody

ABP59271-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131
  • Applications tips:
Description: A polyclonal antibody for detection of MIA from Human. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131

MIA Polyclonal Antibody

ABP59271-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131
  • Applications tips:
Description: A polyclonal antibody for detection of MIA from Human. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131

MIA Polyclonal Antibody

ABP56655-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of MIA from Human, Mouse, Rat. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140

MIA Polyclonal Antibody

ABP56655-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of MIA from Human, Mouse, Rat. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140

MIA Polyclonal Antibody

ABP56655-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140
  • Applications tips:
Description: A polyclonal antibody for detection of MIA from Human, Mouse, Rat. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140

Polyclonal MIA Antibody (Internal)

APG01219G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MIA (Internal). This antibody is tested and proven to work in the following applications:

MIA antibody

70R-36646 100 ug
EUR 327
Description: Rabbit Polyclonal MIA antibody

MIA antibody

70R-MR032 50 ug
EUR 273
Description: Affinity purified Rabbit polyclonal MIA antibody

MIA Antibody

34781-100ul 100ul
EUR 252

MIA Antibody

34781-50ul 50ul
EUR 187

MIA Antibody

CSB-PA759156-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MIA. Recognizes MIA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

MIA Antibody

CSB-PA759156-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against MIA. Recognizes MIA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100

MIA Antibody

1-CSB-PA613694LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MIA Antibody

1-CSB-PA283943
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

MIA Antibody

1-CSB-PA060224
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MIA. Recognizes MIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000

MIA Conjugated Antibody

C34781 100ul
EUR 397

anti- MIA antibody

FNab05173 100µg
EUR 505.25
  • Immunogen: melanoma inhibitory activity
  • Uniprot ID: Q16674
  • Gene ID: 8190
  • Research Area: Stem Cells, Cardiovascular
Description: Antibody raised against MIA

Anti-MIA Antibody

A01570-2 100ul
EUR 397
Description: Rabbit Polyclonal MIA Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Anti-MIA antibody

PAab05173 100 ug
EUR 355

Anti-MIA antibody

STJ94120 200 µl
EUR 197
Description: Rabbit polyclonal to MIA.

Anti-MIA antibody

STJ98978 200 µl
EUR 197
Description: Rabbit polyclonal to MIA.

Mia/ Rat Mia ELISA Kit

ELI-06028r 96 Tests
EUR 886

Polyclonal MIA / CD-RAP Antibody (internal region)

APG00876G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MIA / CD-RAP (internal region). This antibody is tested and proven to work in the following applications:

MIA siRNA

20-abx903250
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIA siRNA

20-abx924118
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIA siRNA

20-abx924119
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MIA protein

30R-2748 20 ug
EUR 358
Description: Purified recombinant Human MIA protein

MIA protein

30R-AM009 5 ug
EUR 127
Description: Purified recombinant Human MIA protein

MIA Antibody, HRP conjugated

1-CSB-PA613694LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MIA Antibody, FITC conjugated

1-CSB-PA613694LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MIA Antibody, Biotin conjugated

1-CSB-PA613694LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MIA cloning plasmid

CSB-CL613694HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 396
  • Sequence: atggcccggtccctggtgtgccttggtgtcatcatcttgctgtctgccttctccggacctggtgtcaggggtggtcctatgcccaagctggctgaccggaagctgtgtgcggaccaggagtgcagccaccctatctccatggctgtggcccttcaggactacatggcccccgactg
  • Show more
Description: A cloning plasmid for the MIA gene.

MIA, human recombinant

4887-100
EUR 805

MIA, human recombinant

4887-1000
EUR 4617

MIA, human recombinant

4887-20
EUR 277

Melanoma Inhibitory Activity (MIA) Antibody

abx430034-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Melanoma Inhibitory Activity (MIA) Antibody

abx235173-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

MIA Rabbit Polyclonal Antibody

Back To Top