MIA Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
MIA Polyclonal Antibody |
ES8773-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MIA from Human. This antibody is tested and validated for IHC, WB, ELISA |
MIA Polyclonal Antibody |
ES8773-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MIA from Human. This antibody is tested and validated for IHC, WB, ELISA |
MIA Polyclonal Antibody |
ABP59271-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131
- Applications tips:
|
Description: A polyclonal antibody for detection of MIA from Human. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131 |
MIA Polyclonal Antibody |
ABP59271-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131
- Applications tips:
|
Description: A polyclonal antibody for detection of MIA from Human. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131 |
MIA Polyclonal Antibody |
ABP59271-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131
- Applications tips:
|
Description: A polyclonal antibody for detection of MIA from Human. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MIA protein at amino acid sequence of 90-131 |
MIA Polyclonal Antibody |
ABP56655-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140
- Applications tips:
|
Description: A polyclonal antibody for detection of MIA from Human, Mouse, Rat. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140 |
MIA Polyclonal Antibody |
ABP56655-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140
- Applications tips:
|
Description: A polyclonal antibody for detection of MIA from Human, Mouse, Rat. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140 |
MIA Polyclonal Antibody |
ABP56655-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140
- Applications tips:
|
Description: A polyclonal antibody for detection of MIA from Human, Mouse, Rat. This MIA antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human MIA at AA range: 60-140 |
Polyclonal MIA Antibody (Internal) |
APG01219G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MIA (Internal). This antibody is tested and proven to work in the following applications: |
MIA antibody |
70R-36646 |
Fitzgerald |
100 ug |
EUR 327 |
Description: Rabbit Polyclonal MIA antibody |
MIA antibody |
70R-MR032 |
Fitzgerald |
50 ug |
EUR 273 |
Description: Affinity purified Rabbit polyclonal MIA antibody |
MIA Antibody |
34781-100ul |
SAB |
100ul |
EUR 252 |
MIA Antibody |
34781-50ul |
SAB |
50ul |
EUR 187 |
MIA Antibody |
CSB-PA759156- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MIA. Recognizes MIA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
MIA Antibody |
CSB-PA759156-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against MIA. Recognizes MIA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;IHC:1:50-1:100 |
MIA Antibody |
1-CSB-PA613694LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
MIA Antibody |
1-CSB-PA283943 |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
|
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000 |
MIA Antibody |
1-CSB-PA060224 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against MIA. Recognizes MIA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000 |
MIA Conjugated Antibody |
C34781 |
SAB |
100ul |
EUR 397 |
anti- MIA antibody |
FNab05173 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: melanoma inhibitory activity
- Uniprot ID: Q16674
- Gene ID: 8190
- Research Area: Stem Cells, Cardiovascular
|
Description: Antibody raised against MIA |
Anti-MIA Antibody |
A01570-2 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal MIA Antibody. Validated in IHC and tested in Human, Mouse, Rat. |
Anti-MIA antibody |
STJ94120 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to MIA. |
Anti-MIA antibody |
STJ98978 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to MIA. |
Polyclonal MIA / CD-RAP Antibody (internal region) |
APG00876G |
Leading Biology |
0.1mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MIA / CD-RAP (internal region). This antibody is tested and proven to work in the following applications: |
MIA siRNA |
20-abx903250 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MIA siRNA |
20-abx924118 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MIA siRNA |
20-abx924119 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MIA protein |
30R-2748 |
Fitzgerald |
20 ug |
EUR 358 |
Description: Purified recombinant Human MIA protein |
MIA protein |
30R-AM009 |
Fitzgerald |
5 ug |
EUR 127 |
Description: Purified recombinant Human MIA protein |
MIA Antibody, HRP conjugated |
1-CSB-PA613694LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MIA Antibody, FITC conjugated |
1-CSB-PA613694LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MIA Antibody, Biotin conjugated |
1-CSB-PA613694LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MIA. Recognizes MIA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
MIA cloning plasmid |
CSB-CL613694HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 396
- Sequence: atggcccggtccctggtgtgccttggtgtcatcatcttgctgtctgccttctccggacctggtgtcaggggtggtcctatgcccaagctggctgaccggaagctgtgtgcggaccaggagtgcagccaccctatctccatggctgtggcccttcaggactacatggcccccgactg
- Show more
|
Description: A cloning plasmid for the MIA gene. |
MIA, human recombinant |
4887-100 |
Biovision |
|
EUR 805 |
MIA, human recombinant |
4887-1000 |
Biovision |
|
EUR 4617 |
MIA, human recombinant |
4887-20 |
Biovision |
|
EUR 277 |
Melanoma Inhibitory Activity (MIA) Antibody |
abx430034-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Melanoma Inhibitory Activity (MIA) Antibody |
abx235173-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
MIA Rabbit Polyclonal Antibody