MKL2 Rabbit Polyclonal Antibody

MKL2 Rabbit Polyclonal Antibody

To Order:

MKL2 Polyclonal Antibody

ABP59287-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MKL2 protein at amino acid sequence of 500-580
  • Applications tips:
Description: A polyclonal antibody for detection of MKL2 from Human, Mouse. This MKL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MKL2 protein at amino acid sequence of 500-580

MKL2 Rabbit pAb

A13113-100ul 100 ul
EUR 308

MKL2 Rabbit pAb

A13113-200ul 200 ul
EUR 459

MKL2 Rabbit pAb

A13113-20ul 20 ul
EUR 183

MKL2 Rabbit pAb

A13113-50ul 50 ul
EUR 223

MKL2 Antibody

ABD8885 100 ug
EUR 438

MKL2 antibody

70R-51394 100 ul
EUR 244
Description: Purified Polyclonal MKL2 antibody

MKL2 Antibody

45564-100ul 100ul
EUR 252

MKL2 Antibody

45564-50ul 50ul
EUR 187

MKL2 Antibody

DF8885 200ul
EUR 304
Description: MKL2 Antibody detects endogenous levels of total MKL2.

MKL2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MKL2. Recognizes MKL2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:500-1:1000

MKL2 Conjugated Antibody

C45564 100ul
EUR 397

Anti-MKL2 antibody

STJ115079 100 µl
EUR 277

Anti-MKL2 antibody

STJ190259 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to MKL2


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MKL2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MKL2. Recognizes MKL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MKL2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MKL2. Recognizes MKL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MKL2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MKL2. Recognizes MKL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MKL2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MKL2 Blocking Peptide

DF8885-BP 1mg
EUR 195

MKL2 cloning plasmid

CSB-CL891962HU-10ug 10ug
EUR 427
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1137
  • Sequence: atgctccagctgaggctgcaacaaaggaggacgagagaacaactagtggaccagggcatcatgccacctttgaagagcccagcggcattccatgaacagataaaaagcttggaacgagccagaactgaaaactttttgaaacacaagattcggagtcgaccagatcgttctgaac
  • Show more
Description: A cloning plasmid for the MKL2 gene.


EF005286 96 Tests
EUR 689

Human MKL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MKL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MKL/myocardin-Like Protein 2 (MKL2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

MKL/myocardin-Like Protein 2 (MKL2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

MKL2 ORF Vector (Human) (pORF)

ORF006508 1.0 ug DNA
EUR 95

Mkl2 ORF Vector (Mouse) (pORF)

ORF050253 1.0 ug DNA
EUR 506

Mkl2 ORF Vector (Mouse) (pORF)

ORF050254 1.0 ug DNA
EUR 506

Mkl2 ORF Vector (Mouse) (pORF)

ORF050255 1.0 ug DNA
EUR 506

MKL2 sgRNA CRISPR Lentivector set (Human)

K1305301 3 x 1.0 ug
EUR 339

Mkl2 sgRNA CRISPR Lentivector set (Mouse)

K4177201 3 x 1.0 ug
EUR 339

MKL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1305302 1.0 ug DNA
EUR 154

MKL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1305303 1.0 ug DNA
EUR 154

MKL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1305304 1.0 ug DNA
EUR 154

Mkl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4177202 1.0 ug DNA
EUR 154

Mkl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4177203 1.0 ug DNA
EUR 154

Mkl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4177204 1.0 ug DNA
EUR 154

MKL2 Protein Vector (Human) (pPB-C-His)

PV026029 500 ng
EUR 329

MKL2 Protein Vector (Human) (pPB-N-His)

PV026030 500 ng
EUR 329

MKL2 Protein Vector (Human) (pPM-C-HA)

PV026031 500 ng
EUR 329

MKL2 Protein Vector (Human) (pPM-C-His)

PV026032 500 ng
EUR 329

MKL2 Protein Vector (Mouse) (pPB-C-His)

PV201010 500 ng
EUR 1065

MKL2 Protein Vector (Mouse) (pPB-N-His)

PV201011 500 ng
EUR 1065

MKL2 Protein Vector (Mouse) (pPM-C-HA)

PV201012 500 ng
EUR 1065

MKL2 Protein Vector (Mouse) (pPM-C-His)

PV201013 500 ng
EUR 1065

MKL2 Protein Vector (Mouse) (pPB-C-His)

PV201014 500 ng
EUR 603

MKL2 Protein Vector (Mouse) (pPB-N-His)

PV201015 500 ng
EUR 603

MKL2 Protein Vector (Mouse) (pPM-C-HA)

PV201016 500 ng
EUR 603

MKL2 Rabbit Polyclonal Antibody

Back To Top