MTF1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
MTF1 Polyclonal Antibody |
ABP59334-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MTF1 protein at amino acid sequence of 260-340
- Applications tips:
|
Description: A polyclonal antibody for detection of MTF1 from Human, Mouse. This MTF1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MTF1 protein at amino acid sequence of 260-340 |
MTF1 Polyclonal Antibody |
ES9060-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MTF1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MTF1 Polyclonal Antibody |
ES9060-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MTF1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MTF1 Antibody |
45522-100ul |
SAB |
100ul |
EUR 252 |
MTF1 Antibody |
45522-50ul |
SAB |
50ul |
EUR 187 |
MTF1 Antibody |
DF8827 |
Affbiotech |
200ul |
EUR 304 |
Description: MTF1 Antibody detects endogenous levels of total MTF1. |
MTF1 Conjugated Antibody |
C45522 |
SAB |
100ul |
EUR 397 |
anti- MTF1 antibody |
FNab05396 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: metal-regulatory transcription factor 1
- Uniprot ID: Q14872
- Gene ID: 4520
- Research Area: Metabolism
|
Description: Antibody raised against MTF1 |
Anti-MTF1 antibody |
STJ190218 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to MTF1 |
MTF1 siRNA |
20-abx924891 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MTF1 siRNA |
20-abx924892 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MTF1 |
YF-PA24176 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to MTF1 |
MTF1 Blocking Peptide |
DF8827-BP |
Affbiotech |
1mg |
EUR 195 |
MTF1 cloning plasmid |
CSB-CL619895HU-10ug |
Cusabio |
10ug |
EUR 742 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2262
- Sequence: atgggggaacacagtccagacaacaacatcatctactttgaggcagaggaagatgagctgacccccgatgataaaatgctcaggtttgtggataaaaacggactggtgccttcctcatctggaactgtttatgataggaccactgttcttattgagcaggaccctggcactttgg
- Show more
|
Description: A cloning plasmid for the MTF1 gene. |
Anti-MTF1 (2E5) |
YF-MA14313 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MTF1 |
Anti-MTF1 (2C12) |
YF-MA14314 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MTF1 |
Anti-MTF1 (3G12) |
YF-MA14315 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to MTF1 |
Anti-MTF1 (4A5) |
YF-MA14316 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to MTF1 |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human) |
4-PAC633Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~His164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1) |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse) |
4-PAC633Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~Tyr139)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1) |
Mouse MTF1 shRNA Plasmid |
20-abx971610 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MTF1 shRNA Plasmid |
20-abx952999 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MTF1 Recombinant Protein (Human) |
RP020269 |
ABM |
100 ug |
Ask for price |
MTF1 Recombinant Protein (Mouse) |
RP152021 |
ABM |
100 ug |
Ask for price |
MTF1 Recombinant Protein (Rat) |
RP212648 |
ABM |
100 ug |
Ask for price |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), APC |
4-PAC633Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~His164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with APC. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), Biotinylated |
4-PAC633Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~His164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with Biotin. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), Cy3 |
4-PAC633Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~His164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with Cy3. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), FITC |
4-PAC633Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~His164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with FITC. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), HRP |
4-PAC633Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~His164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with HRP. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), PE |
4-PAC633Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~His164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with PE. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), APC |
4-PAC633Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~Tyr139)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with APC. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), Biotinylated |
4-PAC633Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~Tyr139)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with Biotin. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), Cy3 |
4-PAC633Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~Tyr139)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with Cy3. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), FITC |
4-PAC633Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~Tyr139)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with FITC. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), HRP |
4-PAC633Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~Tyr139)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with HRP. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), PE |
4-PAC633Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~Tyr139)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with PE. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAC633Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~His164)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with APC-Cy7. |
Metal Regulatory Transcription Factor 1 (MTF1) Polyclonal Antibody (Mouse), APC-Cy7 |
4-PAC633Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MTF1 (Gly2~Tyr139)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse Metal Regulatory Transcription Factor 1 (MTF1). This antibody is labeled with APC-Cy7. |
Metal Regulatory Transcription Factor 1 (MTF1) Antibody |
20-abx216963 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Metal Regulatory Transcription Factor 1 (MTF1) Antibody |
20-abx131698 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Metal Regulatory Transcription Factor 1 (MTF1) Antibody |
20-abx131699 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Metal Regulatory Transcription Factor 1 (MTF1) Antibody |
abx235396-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Mtf1 ORF Vector (Rat) (pORF) |
ORF070884 |
ABM |
1.0 ug DNA |
EUR 506 |
MTF1 ORF Vector (Human) (pORF) |
ORF006757 |
ABM |
1.0 ug DNA |
EUR 95 |
Mtf1 ORF Vector (Mouse) (pORF) |
ORF050675 |
ABM |
1.0 ug DNA |
EUR 506 |
MTF1 ELISA Kit (Human) (OKEH02198) |
OKEH02198 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE).;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL |
Mtf1 sgRNA CRISPR Lentivector set (Rat) |
K6559301 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mtf1 sgRNA CRISPR Lentivector set (Mouse) |
K3833001 |
ABM |
3 x 1.0 ug |
EUR 339 |
MTF1 sgRNA CRISPR Lentivector set (Human) |
K1359901 |
ABM |
3 x 1.0 ug |
EUR 339 |
Mtf1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6559302 |
ABM |
1.0 ug DNA |
EUR 154 |
Mtf1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6559303 |
ABM |
1.0 ug DNA |
EUR 154 |
Mtf1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6559304 |
ABM |
1.0 ug DNA |
EUR 154 |
Mtf1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3833002 |
ABM |
1.0 ug DNA |
EUR 154 |
Mtf1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3833003 |
ABM |
1.0 ug DNA |
EUR 154 |
Mtf1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3833004 |
ABM |
1.0 ug DNA |
EUR 154 |
MTF1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1359902 |
ABM |
1.0 ug DNA |
EUR 154 |
MTF1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1359903 |
ABM |
1.0 ug DNA |
EUR 154 |
MTF1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1359904 |
ABM |
1.0 ug DNA |
EUR 154 |
MTF1 Protein Vector (Mouse) (pPB-C-His) |
PV202698 |
ABM |
500 ng |
EUR 1065 |
MTF1 Protein Vector (Mouse) (pPB-N-His) |
PV202699 |
ABM |
500 ng |
EUR 1065 |
MTF1 Protein Vector (Mouse) (pPM-C-HA) |
PV202700 |
ABM |
500 ng |
EUR 1065 |
MTF1 Protein Vector (Mouse) (pPM-C-His) |
PV202701 |
ABM |
500 ng |
EUR 1065 |
MTF1 Protein Vector (Rat) (pPB-C-His) |
PV283534 |
ABM |
500 ng |
EUR 1191 |
MTF1 Protein Vector (Rat) (pPB-N-His) |
PV283535 |
ABM |
500 ng |
EUR 1191 |
MTF1 Protein Vector (Rat) (pPM-C-HA) |
PV283536 |
ABM |
500 ng |
EUR 1191 |
MTF1 Protein Vector (Rat) (pPM-C-His) |
PV283537 |
ABM |
500 ng |
EUR 1191 |
Recombinant Metal Regulatory Transcription Factor 1 (MTF1) |
4-RPC633Hu01 |
Cloud-Clone |
-
EUR 483.49
-
EUR 232.00
-
EUR 1538.08
-
EUR 579.36
-
EUR 1058.72
-
EUR 386.00
-
EUR 3695.20
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q14872
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 22.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Metal Regulatory Transcription Factor 1 expressed in: E.coli |
Recombinant Metal Regulatory Transcription Factor 1 (MTF1) |
4-RPC633Mu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q07243
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 19.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Metal Regulatory Transcription Factor 1 expressed in: E.coli |
MTF1 Protein Vector (Human) (pPB-C-His) |
PV027025 |
ABM |
500 ng |
EUR 329 |
MTF1 Protein Vector (Human) (pPB-N-His) |
PV027026 |
ABM |
500 ng |
EUR 329 |
MTF1 Protein Vector (Human) (pPM-C-HA) |
PV027027 |
ABM |
500 ng |
EUR 329 |
MTF1 Protein Vector (Human) (pPM-C-His) |
PV027028 |
ABM |
500 ng |
EUR 329 |
Mtf1 3'UTR Luciferase Stable Cell Line |
TU113568 |
ABM |
1.0 ml |
Ask for price |
Mtf1 3'UTR GFP Stable Cell Line |
TU163568 |
ABM |
1.0 ml |
Ask for price |
Mtf1 3'UTR Luciferase Stable Cell Line |
TU213517 |
ABM |
1.0 ml |
Ask for price |
Mtf1 3'UTR GFP Stable Cell Line |
TU263517 |
ABM |
1.0 ml |
Ask for price |
MTF1 3'UTR GFP Stable Cell Line |
TU064873 |
ABM |
1.0 ml |
EUR 1394 |
MTF1 3'UTR Luciferase Stable Cell Line |
TU014873 |
ABM |
1.0 ml |
EUR 1394 |
Human Metal Regulatory Transcription Factor 1 (MTF1) Protein |
20-abx650086 |
Abbexa |
-
EUR 676.00
-
EUR 272.00
-
EUR 2068.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Metal Regulatory Transcription Factor 1 (MTF1) Protein |
20-abx650087 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
MTF1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
LV792139 |
ABM |
1.0 ug DNA |
EUR 316 |
MTF1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
LV792140 |
ABM |
1.0 ug DNA |
EUR 316 |
GAPDH Rabbit Polyclonal Antibody |
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
37985-50ul |
SAB |
50ul |
EUR 187 |
EFHD1 Rabbit Polyclonal Antibody |
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
38001-50ul |
SAB |
50ul |
EUR 187 |
Alliinase Rabbit Polyclonal Antibody |
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
38042-50ul |
SAB |
50ul |
EUR 187 |
ECFP Rabbit Polyclonal Antibody |
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
38077-50ul |
SAB |
50ul |
EUR 187 |
EYFP Rabbit Polyclonal Antibody |
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
38078-50ul |
SAB |
50ul |
EUR 187 |
mOrange Rabbit Polyclonal Antibody |
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
38079-50ul |
SAB |
50ul |
EUR 187 |
mStrawberry Rabbit Polyclonal Antibody |
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
38083-50ul |
SAB |
50ul |
EUR 187 |
AmCyan Rabbit Polyclonal Antibody |
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
38086-50ul |
SAB |
50ul |
EUR 187 |
EBFP Rabbit Polyclonal Antibody |
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
38087-50ul |
SAB |
50ul |
EUR 187 |
Vimentin Rabbit Polyclonal Antibody |
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
38104-50ul |
SAB |
50ul |
EUR 187 |
LDHD Rabbit Polyclonal Antibody |
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
Rabbit Hemoglobin Polyclonal Antibody |
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Met Rabbit Polyclonal Antibody |
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
VEGF Rabbit Polyclonal Antibody |
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
CD10 Rabbit Polyclonal Antibody |
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
NM23A Rabbit Polyclonal Antibody |
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
ATM Rabbit Polyclonal Antibody |
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
ABP57569-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JAK2 Rabbit Polyclonal Antibody |
ABP57570-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JAK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK2 Rabbit Polyclonal Antibody |
ABP57571-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK2
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
JNK3 Rabbit Polyclonal Antibody |
ABP57572-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of JNK3
- Applications tips:
|
Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK2 Rabbit Polyclonal Antibody |
ABP57573-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of MEK2
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2 |
MEK3 Rabbit Polyclonal Antibody |
ABP57574-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of MEK3
- Applications tips:
|
Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3 |
MTF1 Rabbit Polyclonal Antibody