MYL2 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
MYL2 Polyclonal Antibody |
ABP59368-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140
- Applications tips:
|
Description: A polyclonal antibody for detection of MYL2 from Human, Mouse, Rat. This MYL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140 |
MYL2 Polyclonal Antibody |
ABP59368-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140
- Applications tips:
|
Description: A polyclonal antibody for detection of MYL2 from Human, Mouse, Rat. This MYL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140 |
MYL2 Polyclonal Antibody |
ES8862-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MYL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MYL2 Polyclonal Antibody |
ES8862-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MYL2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
MYL2 Rabbit pAb |
A14188-100ul |
Abclonal |
100 ul |
EUR 308 |
MYL2 Rabbit pAb |
A14188-200ul |
Abclonal |
200 ul |
EUR 459 |
MYL2 Rabbit pAb |
A14188-20ul |
Abclonal |
20 ul |
EUR 183 |
MYL2 Rabbit pAb |
A14188-50ul |
Abclonal |
50 ul |
EUR 223 |
MYL2 Rabbit pAb |
A5473-100ul |
Abclonal |
100 ul |
EUR 308 |
MYL2 Rabbit pAb |
A5473-200ul |
Abclonal |
200 ul |
EUR 459 |
MYL2 Rabbit pAb |
A5473-20ul |
Abclonal |
20 ul |
EUR 183 |
MYL2 Rabbit pAb |
A5473-50ul |
Abclonal |
50 ul |
EUR 223 |
Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit |
DLR-MYL2-Hu-48T |
DL Develop |
48T |
EUR 498 |
- Should the Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit |
DLR-MYL2-Hu-96T |
DL Develop |
96T |
EUR 647 |
- Should the Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit |
RDR-MYL2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 522 |
Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit |
RDR-MYL2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 724 |
Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit |
RD-MYL2-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit |
RD-MYL2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
MYL2 antibody |
70R-18708 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MYL2 antibody |
MYL2 Antibody |
35826-100ul |
SAB |
100ul |
EUR 252 |
MYL2 antibody |
38662-100ul |
SAB |
100ul |
EUR 252 |
MYL2 antibody |
10R-2043 |
Fitzgerald |
100 ul |
EUR 349 |
Description: Mouse monoclonal MYL2 antibody |
MYL2 antibody |
10R-1148 |
Fitzgerald |
100 ul |
EUR 316 |
Description: Mouse monoclonal MYL2 antibody |
MYL2 Antibody |
1-CSB-PA10059A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
MYL2 Antibody |
1-CSB-PA107097 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
MYL2 Antibody |
1-CSB-PA015309GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
MYL2 Antibody |
1-CSB-PA181376 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000 |
MYL2 Polyclonal Antibody, HRP Conjugated |
A64121 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
MYL2 Polyclonal Antibody, FITC Conjugated |
A64122 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
MYL2 Polyclonal Antibody, Biotin Conjugated |
A64123 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
Human MYL2 Antibody |
32598-05111 |
AssayPro |
150 ug |
EUR 261 |
MYL2 Conjugated Antibody |
C35826 |
SAB |
100ul |
EUR 397 |
MYL2 Conjugated Antibody |
C38662 |
SAB |
100ul |
EUR 397 |
anti- MYL2 antibody |
FNab05486 |
FN Test |
100µg |
EUR 585 |
- Immunogen: myosin, light chain 2, regulatory, cardiac, slow
- Uniprot ID: P10916
- Gene ID: 4633
- Research Area: Neuroscience, Immunology, Cardiovascular
|
Description: Antibody raised against MYL2 |
Anti-MYL2 antibody |
STJ27426 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy. |
Anti-MYL2 antibody |
STJ116121 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy. |
Anti-MYL2 antibody |
STJ98260 |
St John's Laboratory |
100 µl |
EUR 234 |
Description: Mouse monoclonal to MYL2. |
Anti-MYL2 antibody |
STJ99335 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to MYL2. |
MYL2 protein |
30R-3236 |
Fitzgerald |
50 ug |
EUR 257 |
Description: Purified recombinant MYL2 protein |
MYL2 siRNA |
20-abx903420 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MYL2 siRNA |
20-abx925168 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MYL2 siRNA |
20-abx925169 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MYL2 Antibody, HRP conjugated |
1-CSB-PA10059B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
MYL2 Antibody, FITC conjugated |
1-CSB-PA10059C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
MYL2 Antibody, Biotin conjugated |
1-CSB-PA10059D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Anti-MYL2 Monoclonal Antibody |
A03215 |
BosterBio |
100ul |
EUR 397 |
Description: Mouse Monoclonal Antibody for MYL2 Antibody (MYL2) detection. Tested with WB in Human. |
MYL2 cloning plasmid |
CSB-CL015309HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 501
- Sequence: atggcacctaagaaagcaaagaagagagccgggggcgccaactccaacgtgttctccatgttcgaacagacccaaatccaggaatttaaggaggccttcactatcatggaccagaacagggatggcttcattgacaagaacgatctgagagacacctttgctgcccttgggcgagt
- Show more
|
Description: A cloning plasmid for the MYL2 gene. |
anti-MYL2 (7C9) |
LF-MA30265 |
Abfrontier |
100 ul |
EUR 445 |
Description: Mouse Monoclonal to MYL2 |
Human MYL2 Antibody (Biotin Conjugate) |
32598-05121 |
AssayPro |
150 ug |
EUR 369 |
Monoclonal MYL2 Antibody, Clone: 7C9 |
APR08594G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A Monoclonal antibody against Human MYL2. The antibodies are raised in Mouse and are from clone 7C9. This antibody is applicable in WB, E |
Human MYL2 AssayLite Antibody (FITC Conjugate) |
32598-05141 |
AssayPro |
150 ug |
EUR 428 |
Human MYL2 AssayLite Antibody (RPE Conjugate) |
32598-05151 |
AssayPro |
150 ug |
EUR 428 |
Human MYL2 AssayLite Antibody (APC Conjugate) |
32598-05161 |
AssayPro |
150 ug |
EUR 428 |
Human MYL2 AssayLite Antibody (PerCP Conjugate) |
32598-05171 |
AssayPro |
150 ug |
EUR 471 |
MYL2 protein (His tag) |
80R-1085 |
Fitzgerald |
100 ug |
EUR 305 |
Description: Purified recombinant Human MYL2 protein |
Rat MYL2 shRNA Plasmid |
20-abx990569 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse MYL2 shRNA Plasmid |
20-abx971655 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human MYL2 shRNA Plasmid |
20-abx953058 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MYL2 Recombinant Protein (Human) |
RP020497 |
ABM |
100 ug |
Ask for price |
MYL2 Recombinant Protein (Mouse) |
RP152612 |
ABM |
100 ug |
Ask for price |
MYL2 Recombinant Protein (Rat) |
RP212966 |
ABM |
100 ug |
Ask for price |
Monoclonal MYL2 Antibody (clone AT3B2), Clone: AT3B2 |
AMM01832G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human MYL2 (clone AT3B2). The antibodies are raised in Mouse and are from clone AT3B2. This antibody is applicable in WB and IHC-P, E |
Monoclonal MYL2 Antibody (clone 7C9), Clone: 7C9 |
AMM02192G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A Monoclonal antibody against Human MYL2 (clone 7C9). The antibodies are raised in Mouse and are from clone 7C9. This antibody is applicable in WB and IHC-P, E |
Myl2 ORF Vector (Rat) (pORF) |
ORF070990 |
ABM |
1.0 ug DNA |
EUR 506 |
MYL2 ORF Vector (Human) (pORF) |
ORF006833 |
ABM |
1.0 ug DNA |
EUR 95 |
Myl2 ORF Vector (Mouse) (pORF) |
ORF050872 |
ABM |
1.0 ug DNA |
EUR 506 |
MYL2 ELISA Kit (Human) (OKAN06018) |
OKAN06018 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.1 pg/mL |
MYL2 ELISA Kit (Mouse) (OKCA01725) |
OKCA01725 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
Description: Description of target: Contractile protein that plays a role in heart development and function (PubMed:10409661). Following phosphorylation, plays a role in cross-bridge cycling kinetics and cardiac muscle contraction by increasing myosin lever arm stiffness and promoting myosin head diffusion; as a consequence of the increase in maximum contraction force and calcium sensitivity of contraction force. These events altogether slow down myosin kinetics and prolong duty cycle resulting in accumulated myosins being cooperatively recruited to actin binding sites to sustain thin filament activation as a means to fine-tune myofilament calcium sensitivity to force (PubMed:22426213, PubMed:16908724, PubMed:10409661). During cardiogenesis plays an early role in cardiac contractility by promoting cardiac myofibril assembly (PubMed:9422794).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL |
MYL2 ELISA Kit (Human) (OKCD07142) |
OKCD07142 |
Aviva Systems Biology |
96 Wells |
EUR 936 |
Description: Description of target: Mouse Anti Human Myosin Light Chain 2;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 3.1pg/mL |
MYL2 ELISA Kit (Human) (OKDD00413) |
OKDD00413 |
Aviva Systems Biology |
96 Wells |
EUR 923 |
Description: Description of target: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL |
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
20-abx004193 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
20-abx104173 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
20-abx113950 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
20-abx173687 |
Abbexa |
|
|
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
abx011220-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
20-abx242293 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
20-abx242294 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
abx235486-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
20-abx301981 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody |
20-abx225301 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Myl2 sgRNA CRISPR Lentivector set (Mouse) |
K4687201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Myl2 sgRNA CRISPR Lentivector set (Rat) |
K6363501 |
ABM |
3 x 1.0 ug |
EUR 339 |
MYL2 sgRNA CRISPR Lentivector set (Human) |
K1375401 |
ABM |
3 x 1.0 ug |
EUR 339 |
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig) |
4-PAB102Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYL2 (Ala2~Ile159)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2) |
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody (HRP) |
20-abx306450 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody (FITC) |
20-abx306451 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody (Biotin) |
20-abx306452 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC |
4-PAB102Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYL2 (Ala2~Ile159)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with APC. |
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated |
4-PAB102Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYL2 (Ala2~Ile159)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with Biotin. |
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3 |
4-PAB102Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYL2 (Ala2~Ile159)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with Cy3. |
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC |
4-PAB102Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYL2 (Ala2~Ile159)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with FITC. |
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP |
4-PAB102Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYL2 (Ala2~Ile159)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with HRP. |
Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE |
4-PAB102Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MYL2 (Ala2~Ile159)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with PE. |
Myl2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4687202 |
ABM |
1.0 ug DNA |
EUR 154 |
Myl2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4687203 |
ABM |
1.0 ug DNA |
EUR 154 |
Myl2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4687204 |
ABM |
1.0 ug DNA |
EUR 154 |
Myl2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K6363502 |
ABM |
1.0 ug DNA |
EUR 154 |
Myl2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6363503 |
ABM |
1.0 ug DNA |
EUR 154 |
Myl2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K6363504 |
ABM |
1.0 ug DNA |
EUR 154 |
MYL2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1375402 |
ABM |
1.0 ug DNA |
EUR 154 |
MYL2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1375403 |
ABM |
1.0 ug DNA |
EUR 154 |
MYL2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1375404 |
ABM |
1.0 ug DNA |
EUR 154 |
MYL2 Protein Vector (Mouse) (pPB-C-His) |
PV203486 |
ABM |
500 ng |
EUR 603 |
MYL2 Protein Vector (Mouse) (pPB-N-His) |
PV203487 |
ABM |
500 ng |
EUR 603 |
MYL2 Protein Vector (Mouse) (pPM-C-HA) |
PV203488 |
ABM |
500 ng |
EUR 603 |
MYL2 Protein Vector (Mouse) (pPM-C-His) |
PV203489 |
ABM |
500 ng |
EUR 603 |
MYL2 Protein Vector (Rat) (pPB-C-His) |
PV283958 |
ABM |
500 ng |
EUR 603 |
MYL2 Protein Vector (Rat) (pPB-N-His) |
PV283959 |
ABM |
500 ng |
EUR 603 |
MYL2 Protein Vector (Rat) (pPM-C-HA) |
PV283960 |
ABM |
500 ng |
EUR 603 |
MYL2 Protein Vector (Rat) (pPM-C-His) |
PV283961 |
ABM |
500 ng |
EUR 603 |
MYL2 Protein Vector (Human) (pPB-C-His) |
PV027329 |
ABM |
500 ng |
EUR 329 |
MYL2 Protein Vector (Human) (pPB-N-His) |
PV027330 |
ABM |
500 ng |
EUR 329 |
MYL2 Protein Vector (Human) (pPM-C-HA) |
PV027331 |
ABM |
500 ng |
EUR 329 |
MYL2 Protein Vector (Human) (pPM-C-His) |
PV027332 |
ABM |
500 ng |
EUR 329 |
Myl2 3'UTR Luciferase Stable Cell Line |
TU113715 |
ABM |
1.0 ml |
Ask for price |
Myl2 3'UTR GFP Stable Cell Line |
TU163715 |
ABM |
1.0 ml |
Ask for price |
Myl2 3'UTR Luciferase Stable Cell Line |
TU213634 |
ABM |
1.0 ml |
Ask for price |
Myl2 3'UTR GFP Stable Cell Line |
TU263634 |
ABM |
1.0 ml |
Ask for price |
MYL2 3'UTR GFP Stable Cell Line |
TU065049 |
ABM |
1.0 ml |
EUR 1394 |
MYL2 3'UTR Luciferase Stable Cell Line |
TU015049 |
ABM |
1.0 ml |
EUR 1394 |
MYL2 Rabbit Polyclonal Antibody