MYL2 Rabbit Polyclonal Antibody

MYL2 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

MYL2 Polyclonal Antibody
ABP59368-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140
  • Applications tips:
Description: A polyclonal antibody for detection of MYL2 from Human, Mouse, Rat. This MYL2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYL2 protein at amino acid sequence of 91-140

MYL2 Polyclonal Antibody
A64120 100 µg
EUR 570.55
Description: fast delivery possible

MYL2 Polyclonal Antibody
46911-100ul 100ul
EUR 252

MYL2 Polyclonal Antibody
46911-50ul 50ul
EUR 187

MYL2 Rabbit pAb
A5473-100ul 100 ul
EUR 308

MYL2 Rabbit pAb
A5473-200ul 200 ul
EUR 459

MYL2 Rabbit pAb
A5473-20ul 20 ul
EUR 183

MYL2 Rabbit pAb
A5473-50ul 50 ul
EUR 223

MYL2 Rabbit pAb
A14188-100ul 100 ul
EUR 308

MYL2 Rabbit pAb
A14188-200ul 200 ul
EUR 459

MYL2 Rabbit pAb
A14188-20ul 20 ul
EUR 183

MYL2 Rabbit pAb
A14188-50ul 50 ul
EUR 223

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit
DLR-MYL2-Hu-48T 48T
EUR 498
  • Should the Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit
DLR-MYL2-Hu-96T 96T
EUR 647
  • Should the Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit
RD-MYL2-Hu-48Tests 48 Tests
EUR 500

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit
RD-MYL2-Hu-96Tests 96 Tests
EUR 692

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit
RDR-MYL2-Hu-48Tests 48 Tests
EUR 522

Human Myosin Light Chain 2, Regulatory, Cardiac (MYL2) ELISA Kit
RDR-MYL2-Hu-96Tests 96 Tests
EUR 724

MYL2 Antibody
ABD7911 100 ug
EUR 438

MYL2 Antibody
ABD8007 100 ug
EUR 438

MYL2 Antibody
35826-100ul 100ul
EUR 252

MYL2 antibody
38662-100ul 100ul
EUR 252

MYL2 antibody
10R-1148 100 ul
EUR 316
Description: Mouse monoclonal MYL2 antibody

MYL2 antibody
10R-2043 100 ul
EUR 349
Description: Mouse monoclonal MYL2 antibody

MYL2 antibody
70R-18708 50 ul
EUR 435
Description: Rabbit polyclonal MYL2 antibody

MYL2 Antibody
1-CSB-PA181376
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

MYL2 Antibody
1-CSB-PA10059A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MYL2 Antibody
1-CSB-PA107097
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

MYL2 Antibody
1-CSB-PA015309GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human, Mouse, Rat, Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MYL2 Polyclonal Antibody, HRP Conjugated
A64121 100 µg
EUR 570.55
Description: reagents widely cited

MYL2 Polyclonal Antibody, FITC Conjugated
A64122 100 µg
EUR 570.55
Description: Ask the seller for details

MYL2 Polyclonal Antibody, Biotin Conjugated
A64123 100 µg
EUR 570.55
Description: The best epigenetics products

MYL2 Conjugated Antibody
C38662 100ul
EUR 397

MYL2 Conjugated Antibody
C35826 100ul
EUR 397

anti- MYL2 antibody
FNab05486 100µg
EUR 585
  • Immunogen: myosin, light chain 2, regulatory, cardiac, slow
  • Uniprot ID: P10916
  • Gene ID: 4633
  • Research Area: Neuroscience, Immunology, Cardiovascular
Description: Antibody raised against MYL2

Human MYL2 Antibody
32598-05111 150 ug
EUR 261

Anti-MYL2 antibody
PAab05486 100 ug
EUR 412

Anti-MYL2 antibody
STJ98260 100 µl
EUR 234
Description: Mouse monoclonal to MYL2.

Anti-MYL2 antibody
STJ99335 200 µl
EUR 197
Description: Rabbit polyclonal to MYL2.

Anti-MYL2 antibody
STJ27426 100 µl
EUR 277
Description: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.

Anti-MYL2 antibody
STJ116121 100 µl
EUR 277
Description: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.

Myl2/ Rat Myl2 ELISA Kit
ELI-43717r 96 Tests
EUR 886

MYL2 siRNA
20-abx903420
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYL2 siRNA
20-abx925168
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYL2 siRNA
20-abx925169
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MYL2 protein
30R-3236 50 ug
EUR 257
Description: Purified recombinant MYL2 protein

Rabbit Anti-MYL2 monoclonal antibody, clone TO78-10
DCABH-2673 100 ul
EUR 777

Anti-MYL2 Monoclonal Antibody
A03215 100ul
EUR 397
Description: Mouse Monoclonal Antibody for MYL2 Antibody (MYL2) detection. Tested with WB in Human.

MYL2 Antibody, HRP conjugated
1-CSB-PA10059B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MYL2 Antibody, FITC conjugated
1-CSB-PA10059C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MYL2 Antibody, Biotin conjugated
1-CSB-PA10059D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYL2. Recognizes MYL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MYL2 cloning plasmid
CSB-CL015309HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 501
  • Sequence: atggcacctaagaaagcaaagaagagagccgggggcgccaactccaacgtgttctccatgttcgaacagacccaaatccaggaatttaaggaggccttcactatcatggaccagaacagggatggcttcattgacaagaacgatctgagagacacctttgctgcccttgggcgagt
  • Show more
Description: A cloning plasmid for the MYL2 gene.

anti-MYL2 (7C9)
LF-MA30265 100 ul
EUR 445
Description: Mouse Monoclonal to MYL2

Monoclonal MYL2 Antibody, Clone: 7C9
APR08594G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human MYL2. The antibodies are raised in Mouse and are from clone 7C9. This antibody is applicable in WB, E

Human MYL2 Antibody (Biotin Conjugate)
32598-05121 150 ug
EUR 369

Human MYL2 AssayLite Antibody (FITC Conjugate)
32598-05141 150 ug
EUR 428

Human MYL2 AssayLite Antibody (RPE Conjugate)
32598-05151 150 ug
EUR 428

Human MYL2 AssayLite Antibody (APC Conjugate)
32598-05161 150 ug
EUR 428

Human MYL2 AssayLite Antibody (PerCP Conjugate)
32598-05171 150 ug
EUR 471

Human MYL2 ELISA KIT
ELI-23480h 96 Tests
EUR 824

MYL2 ELISA KIT|Human
EF001031 96 Tests
EUR 689

Mouse Myl2 ELISA KIT
ELI-36623m 96 Tests
EUR 865

Bovine MYL2 ELISA KIT
ELI-45570b 96 Tests
EUR 928

Human MYL2 shRNA Plasmid
20-abx953058
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MYL2 protein (His tag)
80R-1085 100 ug
EUR 305
Description: Purified recombinant Human MYL2 protein

Mouse MYL2 shRNA Plasmid
20-abx971655
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat MYL2 shRNA Plasmid
20-abx990569
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MYL2 Recombinant Protein (Human)
RP020497 100 ug Ask for price

MYL2 Recombinant Protein (Rat)
RP212966 100 ug Ask for price

MYL2 Recombinant Protein (Mouse)
RP152612 100 ug Ask for price

Monoclonal MYL2 Antibody (clone AT3B2), Clone: AT3B2
AMM01832G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human MYL2 (clone AT3B2). The antibodies are raised in Mouse and are from clone AT3B2. This antibody is applicable in WB and IHC-P, E

Monoclonal MYL2 Antibody (clone 7C9), Clone: 7C9
AMM02192G 0.05ml
EUR 484
Description: A Monoclonal antibody against Human MYL2 (clone 7C9). The antibodies are raised in Mouse and are from clone 7C9. This antibody is applicable in WB and IHC-P, E

MYL2 ORF Vector (Human) (pORF)
ORF006833 1.0 ug DNA
EUR 95

Myl2 ORF Vector (Mouse) (pORF)
ORF050872 1.0 ug DNA
EUR 506

Myl2 ORF Vector (Rat) (pORF)
ORF070990 1.0 ug DNA
EUR 506

MYL2 ELISA Kit (Human) (OKAN06018)
OKAN06018 96 Wells
EUR 792
Description: Description of target: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.1 pg/mL

MYL2 ELISA Kit (Human) (OKCD07142)
OKCD07142 96 Wells
EUR 936
Description: Description of target: Mouse Anti Human Myosin Light Chain 2;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 3.1pg/mL

MYL2 ELISA Kit (Human) (OKDD00413)
OKDD00413 96 Wells
EUR 923
Description: Description of target: Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

MYL2 ELISA Kit (Mouse) (OKCA01725)
OKCA01725 96 Wells
EUR 846
Description: Description of target: Contractile protein that plays a role in heart development and function (PubMed:10409661). Following phosphorylation, plays a role in cross-bridge cycling kinetics and cardiac muscle contraction by increasing myosin lever arm stiffness and promoting myosin head diffusion; as a consequence of the increase in maximum contraction force and calcium sensitivity of contraction force. These events altogether slow down myosin kinetics and prolong duty cycle resulting in accumulated myosins being cooperatively recruited to actin binding sites to sustain thin filament activation as a means to fine-tune myofilament calcium sensitivity to force (PubMed:22426213, PubMed:16908724, PubMed:10409661). During cardiogenesis plays an early role in cardiac contractility by promoting cardiac myofibril assembly (PubMed:9422794).;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 3.9 pg/mL

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
20-abx113950
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
20-abx104173
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
abx011220-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
20-abx004193
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
20-abx173687
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
20-abx242293
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
20-abx242294
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
abx235486-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
20-abx301981
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody
20-abx225301
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Myl2 sgRNA CRISPR Lentivector set (Mouse)
K4687201 3 x 1.0 ug
EUR 339

Myl2 sgRNA CRISPR Lentivector set (Rat)
K6363501 3 x 1.0 ug
EUR 339

MYL2 sgRNA CRISPR Lentivector set (Human)
K1375401 3 x 1.0 ug
EUR 339

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig)
4-PAB102Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2)

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody (HRP)
20-abx306450
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody (FITC)
20-abx306451
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Antibody (Biotin)
20-abx306452
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC
4-PAB102Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with APC.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated
4-PAB102Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with Biotin.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3
4-PAB102Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with Cy3.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC
4-PAB102Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with FITC.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP
4-PAB102Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with HRP.

Myosin Light Chain 2, Regulatory, Cardiac (MYL2) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE
4-PAB102Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MYL2 (Ala2~Ile159)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Myosin Light Chain 2, Regulatory, Cardiac (MYL2). This antibody is labeled with PE.

Myl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4687202 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4687203 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4687204 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6363502 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6363503 1.0 ug DNA
EUR 154

Myl2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6363504 1.0 ug DNA
EUR 154

MYL2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1375402 1.0 ug DNA
EUR 154

MYL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1375403 1.0 ug DNA
EUR 154

MYL2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1375404 1.0 ug DNA
EUR 154

MYL2 Protein Vector (Rat) (pPB-C-His)
PV283958 500 ng
EUR 603

MYL2 Protein Vector (Rat) (pPB-N-His)
PV283959 500 ng
EUR 603

MYL2 Protein Vector (Rat) (pPM-C-HA)
PV283960 500 ng
EUR 603

MYL2 Protein Vector (Rat) (pPM-C-His)
PV283961 500 ng
EUR 603

MYL2 Protein Vector (Human) (pPB-C-His)
PV027329 500 ng
EUR 329

MYL2 Protein Vector (Human) (pPB-N-His)
PV027330 500 ng
EUR 329

MYL2 Protein Vector (Human) (pPM-C-HA)
PV027331 500 ng
EUR 329

MYL2 Protein Vector (Human) (pPM-C-His)
PV027332 500 ng
EUR 329

MYL2 Protein Vector (Mouse) (pPB-C-His)
PV203486 500 ng
EUR 603

MYL2 Protein Vector (Mouse) (pPB-N-His)
PV203487 500 ng
EUR 603

MYL2 Protein Vector (Mouse) (pPM-C-HA)
PV203488 500 ng
EUR 603

MYL2 Protein Vector (Mouse) (pPM-C-His)
PV203489 500 ng
EUR 603

Myl2 3'UTR GFP Stable Cell Line
TU163715 1.0 ml Ask for price

Myl2 3'UTR Luciferase Stable Cell Line
TU213634 1.0 ml Ask for price

MYL2 3'UTR Luciferase Stable Cell Line
TU015049 1.0 ml
EUR 1394

Myl2 3'UTR Luciferase Stable Cell Line
TU113715 1.0 ml Ask for price

MYL2 3'UTR GFP Stable Cell Line
TU065049 1.0 ml
EUR 1394

Myl2 3'UTR GFP Stable Cell Line
TU263634 1.0 ml Ask for price

MYL2 Rabbit Polyclonal Antibody

Back To Top