NCOA1 Rabbit Polyclonal Antibody

NCOA1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

NCOA1 Polyclonal Antibody
ABP59411-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NCOA1 protein at amino acid sequence of 1120-1200
  • Applications tips:
Description: A polyclonal antibody for detection of NCOA1 from Human, Mouse. This NCOA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NCOA1 protein at amino acid sequence of 1120-1200

NCOA1 Polyclonal Antibody
ABP59411-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NCOA1 protein at amino acid sequence of 1120-1200
  • Applications tips:
Description: A polyclonal antibody for detection of NCOA1 from Human, Mouse. This NCOA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NCOA1 protein at amino acid sequence of 1120-1200

NCOA1 Rabbit pAb
A1128-100ul 100 ul
EUR 308

NCOA1 Rabbit pAb
A1128-200ul 200 ul
EUR 459

NCOA1 Rabbit pAb
A1128-20ul 20 ul
EUR 183

NCOA1 Rabbit pAb
A1128-50ul 50 ul
EUR 223

NCOA1 Rabbit pAb
A0765-100ul 100 ul
EUR 308

NCOA1 Rabbit pAb
A0765-200ul 200 ul
EUR 459

NCOA1 Rabbit pAb
A0765-20ul 20 ul Ask for price

NCOA1 Rabbit pAb
A0765-50ul 50 ul Ask for price

NCOA1 Antibody
ABD2648 100 ug
EUR 438

NCOA1 Antibody
ABD6263 100 ug
EUR 438

NCOA1 antibody
38196-100ul 100ul
EUR 252

NCOA1 antibody
10R-1597 50 ug
EUR 242
Description: Mouse monoclonal NCOA1 antibody

NCOA1 Antibody
6153-100
EUR 414

NCOA1 antibody
70R-18785 50 ul
EUR 435
Description: Rabbit polyclonal NCOA1 antibody

NCOA1 Antibody
DF6263 200ul
EUR 304
Description: NCOA1 Antibody detects endogenous levels of total NCOA1.

NCOA1 Antibody
DF2648 200ul
EUR 304
Description: NCOA1 antibody detects endogenous levels of total NCOA1.

NCOA1 Antibody
1-CSB-PA015539GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NCOA1 Antibody
1-CSB-PA015539HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NCOA1 Conjugated Antibody
C38196 100ul
EUR 397

Anti-NCOA1 antibody
STJ24704 100 µl
EUR 277
Description: The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-NCOA1 antibody
STJ24705 100 µl
EUR 277
Description: The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified.

Anti-NCOA1 antibody
STJ190140 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NCOA1

NCOA1 siRNA
20-abx925520
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NCOA1 siRNA
20-abx925521
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NCOA1 Antibody, HRP conjugated
1-CSB-PA015539HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NCOA1 Antibody, FITC conjugated
1-CSB-PA015539HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NCOA1 Antibody, Biotin conjugated
1-CSB-PA015539HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NCOA1 cloning plasmid
CSB-CL015539HU-10ug 10ug
EUR 1693
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 4326
  • Sequence: ATGAGTGGCCTCGGGGACAGTTCATCCGACCCTGCTAACCCAGACTCACATAAGAGGAAAGGATCGCCATGTGACACACTGGCATCAAGCACGGAAAAGAGGCGCAGGGAGCAAGAAAATAAATATTTAGAAGAACTAGCTGAGTTACTGTCTGCCAACATTAGTGACATTGACA
  • Show more
Description: A cloning plasmid for the NCOA1 gene.

NCOA1 Blocking Peptide
DF6263-BP 1mg
EUR 195

NCOA1 Blocking Peptide
DF2648-BP 1mg
EUR 195

Anti-KAT13A/SRC1/NCOA1 Antibody
RP1056 100ug/vial
EUR 294

Rabbit Nuclear receptor coactivator 1(NCOA1) ELISA kit
E04N0540-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear receptor coactivator 1(NCOA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Nuclear receptor coactivator 1(NCOA1) ELISA kit
E04N0540-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear receptor coactivator 1(NCOA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Nuclear receptor coactivator 1(NCOA1) ELISA kit
E04N0540-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear receptor coactivator 1(NCOA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Nuclear Receptor Coactivator 1 (NCOA1) Antibody
20-abx000852
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Coactivator 1 (NCOA1) Antibody
20-abx001042
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Coactivator 1 (NCOA1) Antibody
abx147484-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Nuclear Receptor Coactivator 1 (NCOA1) Antibody
20-abx312935
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human NCOA1 ELISA Kit
ELA-E0335h 96 Tests
EUR 824

NCOA1 ELISA KIT|Human
EF000575 96 Tests
EUR 689

Human NCOA1 shRNA Plasmid
20-abx955686
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NCOA1 shRNA Plasmid
20-abx971695
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NCOA1/SRC-1/KAT13A/ Rat NCOA1/ SRC- 1/ KAT13A ELISA Kit
ELA-E11292r 96 Tests
EUR 886

Nuclear Receptor Coactivator 1 (NCOA1) Antibody (HRP)
20-abx312936
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Receptor Coactivator 1 (NCOA1) Antibody (FITC)
20-abx312937
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nuclear Receptor Coactivator 1 (NCOA1) Antibody (Biotin)
20-abx312938
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ncoa1 ORF Vector (Rat) (pORF)
ORF071137 1.0 ug DNA
EUR 2080

NCOA1 ORF Vector (Human) (pORF)
ORF013857 1.0 ug DNA
EUR 354

Ncoa1 ORF Vector (Mouse) (pORF)
ORF051101 1.0 ug DNA
EUR 1572

NCOA1 ELISA Kit (Human) (OKEH04299)
OKEH04299 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

NCOA1 ELISA Kit (Mouse) (OKEH05857)
OKEH05857 96 Wells
EUR 662
Description: Description of target: Nuclear receptor coactivator that directly binds nuclear receptors and stimulates the transcriptional activities in a hormone-dependent fashion. Involved in the coactivation of different nuclear receptors, such as for steroids (PGR, GR and ER), retinoids (RXRs), thyroid hormone (TRs) and prostanoids (PPARs). Also involved in coactivation mediated by STAT3, STAT5A, STAT5B and STAT6 transcription factors. Displays histone acetyltransferase activity toward H3 and H4; the relevance of such activity remains however unclear. Plays a central role in creating multisubunit coactivator complexes that act via remodeling of chromatin, and possibly acts by participating in both chromatin remodeling and recruitment of general transcription factors. Required with NCOA2 to control energy balance between white and brown adipose tissues. Required for mediating steroid hormone response. Isoform 2 has a higher thyroid hormone-dependent transactivation activity than isoform 1 and isoform 3.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL

NCOA1 sgRNA CRISPR Lentivector set (Human)
K1399701 3 x 1.0 ug
EUR 339

Ncoa1 sgRNA CRISPR Lentivector set (Mouse)
K3986801 3 x 1.0 ug
EUR 339

Ncoa1 sgRNA CRISPR Lentivector set (Rat)
K7607901 3 x 1.0 ug
EUR 339

NCOA1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1399702 1.0 ug DNA
EUR 154

NCOA1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1399703 1.0 ug DNA
EUR 154

NCOA1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1399704 1.0 ug DNA
EUR 154

Ncoa1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3986802 1.0 ug DNA
EUR 154

Ncoa1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3986803 1.0 ug DNA
EUR 154

Ncoa1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3986804 1.0 ug DNA
EUR 154

Ncoa1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7607902 1.0 ug DNA
EUR 154

Ncoa1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7607903 1.0 ug DNA
EUR 154

Ncoa1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7607904 1.0 ug DNA
EUR 154

NCOA1 Protein Vector (Human) (pPB-C-His)
PV055425 500 ng
EUR 481

NCOA1 Protein Vector (Human) (pPB-N-His)
PV055426 500 ng
EUR 481

NCOA1 Protein Vector (Human) (pPM-C-HA)
PV055427 500 ng
EUR 481

NCOA1 Protein Vector (Human) (pPM-C-His)
PV055428 500 ng
EUR 481

NCOA1 Protein Vector (Rat) (pPB-C-His)
PV284546 500 ng
EUR 2411

NCOA1 Protein Vector (Rat) (pPB-N-His)
PV284547 500 ng
EUR 2411

NCOA1 Protein Vector (Rat) (pPM-C-HA)
PV284548 500 ng
EUR 2411

NCOA1 Protein Vector (Rat) (pPM-C-His)
PV284549 500 ng
EUR 2411

NCOA1 Protein Vector (Mouse) (pPB-C-His)
PV204402 500 ng
EUR 2393

NCOA1 Protein Vector (Mouse) (pPB-N-His)
PV204403 500 ng
EUR 2393

NCOA1 Protein Vector (Mouse) (pPM-C-HA)
PV204404 500 ng
EUR 2393

NCOA1 Protein Vector (Mouse) (pPM-C-His)
PV204405 500 ng
EUR 2393

Ncoa1 3'UTR GFP Stable Cell Line
TU163893 1.0 ml Ask for price

NCOA1 Rabbit Polyclonal Antibody

Back To Top