NCOA1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
NCOA1 Polyclonal Antibody |
ABP59411-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NCOA1 protein at amino acid sequence of 1120-1200
- Applications tips:
|
Description: A polyclonal antibody for detection of NCOA1 from Human, Mouse. This NCOA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NCOA1 protein at amino acid sequence of 1120-1200 |
NCOA1 Polyclonal Antibody |
ABP59411-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NCOA1 protein at amino acid sequence of 1120-1200
- Applications tips:
|
Description: A polyclonal antibody for detection of NCOA1 from Human, Mouse. This NCOA1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NCOA1 protein at amino acid sequence of 1120-1200 |
NCOA1 Rabbit pAb |
A1128-100ul |
Abclonal |
100 ul |
EUR 308 |
NCOA1 Rabbit pAb |
A1128-200ul |
Abclonal |
200 ul |
EUR 459 |
NCOA1 Rabbit pAb |
A1128-20ul |
Abclonal |
20 ul |
EUR 183 |
NCOA1 Rabbit pAb |
A1128-50ul |
Abclonal |
50 ul |
EUR 223 |
NCOA1 Rabbit pAb |
A0765-100ul |
Abclonal |
100 ul |
EUR 308 |
NCOA1 Rabbit pAb |
A0765-200ul |
Abclonal |
200 ul |
EUR 459 |
NCOA1 Rabbit pAb |
A0765-20ul |
Abclonal |
20 ul |
Ask for price |
NCOA1 Rabbit pAb |
A0765-50ul |
Abclonal |
50 ul |
Ask for price |
NCOA1 antibody |
38196-100ul |
SAB |
100ul |
EUR 252 |
NCOA1 antibody |
10R-1597 |
Fitzgerald |
50 ug |
EUR 242 |
Description: Mouse monoclonal NCOA1 antibody |
NCOA1 antibody |
70R-18785 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NCOA1 antibody |
NCOA1 Antibody |
DF6263 |
Affbiotech |
200ul |
EUR 304 |
Description: NCOA1 Antibody detects endogenous levels of total NCOA1. |
NCOA1 Antibody |
DF2648 |
Affbiotech |
200ul |
EUR 304 |
Description: NCOA1 antibody detects endogenous levels of total NCOA1. |
NCOA1 Antibody |
1-CSB-PA015539GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
NCOA1 Antibody |
1-CSB-PA015539HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NCOA1 Conjugated Antibody |
C38196 |
SAB |
100ul |
EUR 397 |
Anti-NCOA1 antibody |
STJ24704 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. |
Anti-NCOA1 antibody |
STJ24705 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. |
Anti-NCOA1 antibody |
STJ190140 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NCOA1 |
NCOA1 siRNA |
20-abx925520 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NCOA1 siRNA |
20-abx925521 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NCOA1 Antibody, HRP conjugated |
1-CSB-PA015539HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NCOA1 Antibody, FITC conjugated |
1-CSB-PA015539HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NCOA1 Antibody, Biotin conjugated |
1-CSB-PA015539HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NCOA1. Recognizes NCOA1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NCOA1 cloning plasmid |
CSB-CL015539HU-10ug |
Cusabio |
10ug |
EUR 1693 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 4326
- Sequence: ATGAGTGGCCTCGGGGACAGTTCATCCGACCCTGCTAACCCAGACTCACATAAGAGGAAAGGATCGCCATGTGACACACTGGCATCAAGCACGGAAAAGAGGCGCAGGGAGCAAGAAAATAAATATTTAGAAGAACTAGCTGAGTTACTGTCTGCCAACATTAGTGACATTGACA
- Show more
|
Description: A cloning plasmid for the NCOA1 gene. |
NCOA1 Blocking Peptide |
DF6263-BP |
Affbiotech |
1mg |
EUR 195 |
NCOA1 Blocking Peptide |
DF2648-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-KAT13A/SRC1/NCOA1 Antibody |
RP1056 |
BosterBio |
100ug/vial |
EUR 294 |
Rabbit Nuclear receptor coactivator 1(NCOA1) ELISA kit |
E04N0540-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear receptor coactivator 1(NCOA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nuclear receptor coactivator 1(NCOA1) ELISA kit |
E04N0540-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear receptor coactivator 1(NCOA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Nuclear receptor coactivator 1(NCOA1) ELISA kit |
E04N0540-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Nuclear receptor coactivator 1(NCOA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Nuclear Receptor Coactivator 1 (NCOA1) Antibody |
20-abx000852 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Coactivator 1 (NCOA1) Antibody |
20-abx001042 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Coactivator 1 (NCOA1) Antibody |
abx147484-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Coactivator 1 (NCOA1) Antibody |
20-abx312935 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human NCOA1 shRNA Plasmid |
20-abx955686 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NCOA1 shRNA Plasmid |
20-abx971695 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NCOA1/SRC-1/KAT13A/ Rat NCOA1/ SRC- 1/ KAT13A ELISA Kit |
ELA-E11292r |
Lifescience Market |
96 Tests |
EUR 886 |
Nuclear Receptor Coactivator 1 (NCOA1) Antibody (HRP) |
20-abx312936 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Coactivator 1 (NCOA1) Antibody (FITC) |
20-abx312937 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Coactivator 1 (NCOA1) Antibody (Biotin) |
20-abx312938 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Ncoa1 ORF Vector (Rat) (pORF) |
ORF071137 |
ABM |
1.0 ug DNA |
EUR 2080 |
NCOA1 ORF Vector (Human) (pORF) |
ORF013857 |
ABM |
1.0 ug DNA |
EUR 354 |
Ncoa1 ORF Vector (Mouse) (pORF) |
ORF051101 |
ABM |
1.0 ug DNA |
EUR 1572 |
NCOA1 ELISA Kit (Human) (OKEH04299) |
OKEH04299 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
NCOA1 ELISA Kit (Mouse) (OKEH05857) |
OKEH05857 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Nuclear receptor coactivator that directly binds nuclear receptors and stimulates the transcriptional activities in a hormone-dependent fashion. Involved in the coactivation of different nuclear receptors, such as for steroids (PGR, GR and ER), retinoids (RXRs), thyroid hormone (TRs) and prostanoids (PPARs). Also involved in coactivation mediated by STAT3, STAT5A, STAT5B and STAT6 transcription factors. Displays histone acetyltransferase activity toward H3 and H4; the relevance of such activity remains however unclear. Plays a central role in creating multisubunit coactivator complexes that act via remodeling of chromatin, and possibly acts by participating in both chromatin remodeling and recruitment of general transcription factors. Required with NCOA2 to control energy balance between white and brown adipose tissues. Required for mediating steroid hormone response. Isoform 2 has a higher thyroid hormone-dependent transactivation activity than isoform 1 and isoform 3.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.08 ng/mL |
NCOA1 sgRNA CRISPR Lentivector set (Human) |
K1399701 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ncoa1 sgRNA CRISPR Lentivector set (Mouse) |
K3986801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ncoa1 sgRNA CRISPR Lentivector set (Rat) |
K7607901 |
ABM |
3 x 1.0 ug |
EUR 339 |
NCOA1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1399702 |
ABM |
1.0 ug DNA |
EUR 154 |
NCOA1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1399703 |
ABM |
1.0 ug DNA |
EUR 154 |
NCOA1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1399704 |
ABM |
1.0 ug DNA |
EUR 154 |
Ncoa1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3986802 |
ABM |
1.0 ug DNA |
EUR 154 |
Ncoa1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3986803 |
ABM |
1.0 ug DNA |
EUR 154 |
Ncoa1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3986804 |
ABM |
1.0 ug DNA |
EUR 154 |
Ncoa1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7607902 |
ABM |
1.0 ug DNA |
EUR 154 |
Ncoa1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7607903 |
ABM |
1.0 ug DNA |
EUR 154 |
Ncoa1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7607904 |
ABM |
1.0 ug DNA |
EUR 154 |
NCOA1 Protein Vector (Human) (pPB-C-His) |
PV055425 |
ABM |
500 ng |
EUR 481 |
NCOA1 Protein Vector (Human) (pPB-N-His) |
PV055426 |
ABM |
500 ng |
EUR 481 |
NCOA1 Protein Vector (Human) (pPM-C-HA) |
PV055427 |
ABM |
500 ng |
EUR 481 |
NCOA1 Protein Vector (Human) (pPM-C-His) |
PV055428 |
ABM |
500 ng |
EUR 481 |
NCOA1 Protein Vector (Rat) (pPB-C-His) |
PV284546 |
ABM |
500 ng |
EUR 2411 |
NCOA1 Protein Vector (Rat) (pPB-N-His) |
PV284547 |
ABM |
500 ng |
EUR 2411 |
NCOA1 Protein Vector (Rat) (pPM-C-HA) |
PV284548 |
ABM |
500 ng |
EUR 2411 |
NCOA1 Protein Vector (Rat) (pPM-C-His) |
PV284549 |
ABM |
500 ng |
EUR 2411 |
NCOA1 Protein Vector (Mouse) (pPB-C-His) |
PV204402 |
ABM |
500 ng |
EUR 2393 |
NCOA1 Protein Vector (Mouse) (pPB-N-His) |
PV204403 |
ABM |
500 ng |
EUR 2393 |
NCOA1 Protein Vector (Mouse) (pPM-C-HA) |
PV204404 |
ABM |
500 ng |
EUR 2393 |
NCOA1 Protein Vector (Mouse) (pPM-C-His) |
PV204405 |
ABM |
500 ng |
EUR 2393 |
Ncoa1 3'UTR GFP Stable Cell Line |
TU163893 |
ABM |
1.0 ml |
Ask for price |
NCOA1 Rabbit Polyclonal Antibody