NDEL1 Rabbit Polyclonal Antibody

NDEL1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

NDEL1 Polyclonal Antibody

ABP59415-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of NDEL1 from Human, Mouse, Rat. This NDEL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240

NDEL1 Polyclonal Antibody

ES9004-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NDEL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NDEL1 Polyclonal Antibody

ES9004-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NDEL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NDEL1 Rabbit pAb

A5776-100ul 100 ul
EUR 308

NDEL1 Rabbit pAb

A5776-200ul 200 ul
EUR 459

NDEL1 Rabbit pAb

A5776-20ul 20 ul
EUR 183

NDEL1 Rabbit pAb

A5776-50ul 50 ul
EUR 223

Polyclonal NDEL1 Antibody (Center)

AMM06578G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NDEL1 (Center). This antibody is tested and proven to work in the following applications:

NDEL1 antibody

70R-18793 50 ul
EUR 435
Description: Rabbit polyclonal NDEL1 antibody

NDEL1 Antibody

33038-100ul 100ul
EUR 252

NDEL1 antibody

10R-4928 100 ul
EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody

10R-4929 100 ul
EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody

10R-4930 100 ul
EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody

10R-4931 100 ul
EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody

10R-4932 100 ul
EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 antibody

10R-4933 100 ul
EUR 691
Description: Mouse monoclonal NDEL1 antibody

NDEL1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NDEL1. Recognizes NDEL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NDEL1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NDEL1. Recognizes NDEL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

NDEL1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NDEL1. Recognizes NDEL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NDEL1 Antibody

AF7025 200ul
EUR 376
Description: NDEL1 Antibody detects endogenous levels of NDEL1 .

Polyclonal Goat Anti-NDEL1 Antibody

APR12128G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NDEL1 . This antibody is tested and proven to work in the following applications:

NDEL1 (Phospho-Thr219) Polyclonal Conjugated Antibody

C12766 100ul
EUR 397

Ndel1/ Rat Ndel1 ELISA Kit

ELI-38373r 96 Tests
EUR 886

NDEL1 (pT219) Antibody

abx217078-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

NDEL1 Conjugated Antibody

C33038 100ul
EUR 397

anti- NDEL1 antibody

FNab05601 100µg
EUR 505.25
  • Immunogen: nudE nuclear distribution gene E homolog(A. nidulans)-like 1
  • Uniprot ID: Q9GZM8
  • Gene ID: 81565
  • Research Area: Neuroscience, Cell Division and Proliferation, Developmental biology
Description: Antibody raised against NDEL1

Anti-NDEL1 antibody

PAab05601 100 ug
EUR 355

Anti-NDEL1 antibody

STJ28343 100 µl
EUR 277
Description: This gene encodes a coiled-coil protein that plays a role in multiple processes including cytoskeletal organization, cell signaling and neuron migration, outgrowth and maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome X.

Anti-NDEL1 antibody

STJ71835 100 µg
EUR 359

Anti-NDEL1 antibody

STJ190162 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NDEL1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NDEL1 (Phospho-Thr219) Antibody

12766-100ul 100ul
EUR 252

NDEL1 (Phospho-Thr219) Antibody

12766-50ul 50ul
EUR 187

Phospho-NDEL1 (Thr219) Antibody

AF8492 200ul
EUR 376
Description: NDEL1 (Phospho-Thr219) Antibody detects endogenous levels of NDEL1 only when phosphorylated at Thr219.

NDEL1 (Phospho- Thr219) Antibody

ABF8492 100 ug
EUR 438

NDEL1 Blocking Peptide

AF7025-BP 1mg
EUR 195

NDEL1 cloning plasmid

CSB-CL872414HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1038
  • Sequence: atggatggtgaagatataccagatttttcaagtttaaaggaggaaactgcttattggaaggaactttccttgaagtataagcaaagcttccaggaagctcgggatgagctagttgaattccaggaaggaagcagagaattagaagcagagttggaggcacaattagtacaggctg
  • Show more
Description: A cloning plasmid for the NDEL1 gene.

NDEL1 protein (His tag)

80R-3923 50 ug
EUR 435
Description: Purified recombinant NDEL1 protein (His tag)


ELI-20675c 96 Tests
EUR 928


EF001123 96 Tests
EUR 689

Rat NDEL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NDEL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NDEL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NDEL1 Recombinant Protein (Human)

RP020881 100 ug Ask for price

NDEL1 Recombinant Protein (Mouse)

RP153371 100 ug Ask for price

NDEL1 Recombinant Protein (Rat)

RP213443 100 ug Ask for price

Phospho-NDEL1 (Thr219) Blocking Peptide

AF8492-BP 1mg
EUR 195

Ndel1 ORF Vector (Rat) (pORF)

ORF071149 1.0 ug DNA
EUR 506

NDEL1 ORF Vector (Human) (pORF)

ORF006961 1.0 ug DNA
EUR 95

Ndel1 ORF Vector (Mouse) (pORF)

ORF051125 1.0 ug DNA
EUR 506

Rabbit Nuclear distribution protein nudE- like 1, NDEL1 ELISA KI

ELI-36714Ra 96 Tests
EUR 928

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 Like 1 (Ndel1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody

abx235601-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody

abx432229-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ndel1 sgRNA CRISPR Lentivector set (Rat)

K7045001 3 x 1.0 ug
EUR 339

NDEL1 sgRNA CRISPR Lentivector set (Human)

K1406501 3 x 1.0 ug
EUR 339

Ndel1 sgRNA CRISPR Lentivector set (Mouse)

K4726801 3 x 1.0 ug
EUR 339

Ndel1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7045002 1.0 ug DNA
EUR 154

Ndel1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7045003 1.0 ug DNA
EUR 154

Ndel1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7045004 1.0 ug DNA
EUR 154

NDEL1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1406502 1.0 ug DNA
EUR 154

NDEL1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1406503 1.0 ug DNA
EUR 154

NDEL1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1406504 1.0 ug DNA
EUR 154

Ndel1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4726802 1.0 ug DNA
EUR 154

Ndel1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4726803 1.0 ug DNA
EUR 154

Ndel1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4726804 1.0 ug DNA
EUR 154

NDEL1 Protein Vector (Mouse) (pPB-C-His)

PV204498 500 ng
EUR 603

NDEL1 Protein Vector (Mouse) (pPB-N-His)

PV204499 500 ng
EUR 603

NDEL1 Protein Vector (Mouse) (pPM-C-HA)

PV204500 500 ng
EUR 603

NDEL1 Protein Vector (Mouse) (pPM-C-His)

PV204501 500 ng
EUR 603

NDEL1 Protein Vector (Rat) (pPB-C-His)

PV284594 500 ng
EUR 603

NDEL1 Protein Vector (Rat) (pPB-N-His)

PV284595 500 ng
EUR 603

NDEL1 Protein Vector (Rat) (pPM-C-HA)

PV284596 500 ng
EUR 603

NDEL1 Protein Vector (Rat) (pPM-C-His)

PV284597 500 ng
EUR 603

NDEL1 Protein Vector (Human) (pPB-C-His)

PV027841 500 ng
EUR 329

NDEL1 Protein Vector (Human) (pPB-N-His)

PV027842 500 ng
EUR 329

NDEL1 Protein Vector (Human) (pPM-C-HA)

PV027843 500 ng
EUR 329

NDEL1 Protein Vector (Human) (pPM-C-His)

PV027844 500 ng
EUR 329

Ndel1 3'UTR Luciferase Stable Cell Line

TU113908 1.0 ml Ask for price

Ndel1 3'UTR GFP Stable Cell Line

TU163908 1.0 ml Ask for price

Ndel1 3'UTR Luciferase Stable Cell Line

TU213805 1.0 ml Ask for price

Ndel1 3'UTR GFP Stable Cell Line

TU263805 1.0 ml Ask for price

NDEL1 3'UTR GFP Stable Cell Line

TU065468 1.0 ml
EUR 1394

NDEL1 3'UTR Luciferase Stable Cell Line

TU015468 1.0 ml
EUR 1394

Human Nuclear distribution protein nudE-like 1 (NDEL1)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Nuclear distribution protein nudE-like 1(NDEL1) expressed in E.coli

NDEL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV675163 1.0 ug DNA
EUR 682

NDEL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV675167 1.0 ug DNA
EUR 682

NDEL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV675168 1.0 ug DNA
EUR 682

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

NDEL1 Rabbit Polyclonal Antibody

Back To Top