NDEL1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
NDEL1 Polyclonal Antibody |
ABP59415-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of NDEL1 from Human, Mouse, Rat. This NDEL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240 |
NDEL1 Polyclonal Antibody |
ABP59415-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of NDEL1 from Human, Mouse, Rat. This NDEL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240 |
NDEL1 Polyclonal Antibody |
ABP59415-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240
- Applications tips:
|
Description: A polyclonal antibody for detection of NDEL1 from Human, Mouse, Rat. This NDEL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NDEL1 protein at amino acid sequence of 160-240 |
NDEL1 Rabbit pAb |
A5776-100ul |
Abclonal |
100 ul |
EUR 308 |
NDEL1 Rabbit pAb |
A5776-200ul |
Abclonal |
200 ul |
EUR 459 |
NDEL1 Rabbit pAb |
A5776-20ul |
Abclonal |
20 ul |
EUR 183 |
NDEL1 Rabbit pAb |
A5776-50ul |
Abclonal |
50 ul |
EUR 223 |
Polyclonal NDEL1 Antibody (Center) |
AMM06578G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NDEL1 (Center). This antibody is tested and proven to work in the following applications: |
NDEL1 Antibody |
AF7025 |
Affbiotech |
200ul |
EUR 376 |
Description: NDEL1 Antibody detects endogenous levels of NDEL1 . |
NDEL1 Antibody |
33038-100ul |
SAB |
100ul |
EUR 252 |
NDEL1 antibody |
10R-4928 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal NDEL1 antibody |
NDEL1 antibody |
10R-4929 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal NDEL1 antibody |
NDEL1 antibody |
10R-4930 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal NDEL1 antibody |
NDEL1 antibody |
10R-4931 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal NDEL1 antibody |
NDEL1 antibody |
10R-4932 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal NDEL1 antibody |
NDEL1 antibody |
10R-4933 |
Fitzgerald |
100 ul |
EUR 691 |
Description: Mouse monoclonal NDEL1 antibody |
NDEL1 antibody |
70R-18793 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NDEL1 antibody |
NDEL1 Antibody |
1-CSB-PA967640 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NDEL1. Recognizes NDEL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
NDEL1 Antibody |
1-CSB-PA872414ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NDEL1. Recognizes NDEL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA |
NDEL1 Antibody |
1-CSB-PA015603GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NDEL1. Recognizes NDEL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Polyclonal Goat Anti-NDEL1 Antibody |
APR12128G |
Leading Biology |
0.1 mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-NDEL1 . This antibody is tested and proven to work in the following applications: |
NDEL1 (Phospho-Thr219) Polyclonal Conjugated Antibody |
C12766 |
SAB |
100ul |
EUR 397 |
NDEL1 Conjugated Antibody |
C33038 |
SAB |
100ul |
EUR 397 |
anti- NDEL1 antibody |
FNab05601 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: nudE nuclear distribution gene E homolog(A. nidulans)-like 1
- Uniprot ID: Q9GZM8
- Gene ID: 81565
- Research Area: Neuroscience, Cell Division and Proliferation, Developmental biology
|
Description: Antibody raised against NDEL1 |
NDEL1 (pT219) Antibody |
abx217078-100ug |
Abbexa |
100 ug |
EUR 439 |
- Shipped within 5-10 working days.
|
Anti-NDEL1 antibody |
STJ28343 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a coiled-coil protein that plays a role in multiple processes including cytoskeletal organization, cell signaling and neuron migration, outgrowth and maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome X. |
Anti-NDEL1 antibody |
STJ190162 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NDEL1 |
NDEL1 siRNA |
20-abx903498 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NDEL1 siRNA |
20-abx925549 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NDEL1 siRNA |
20-abx925550 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Phospho-NDEL1 (Thr219) Antibody |
AF8492 |
Affbiotech |
200ul |
EUR 376 |
Description: NDEL1 (Phospho-Thr219) Antibody detects endogenous levels of NDEL1 only when phosphorylated at Thr219. |
NDEL1 (Phospho-Thr219) Antibody |
12766-100ul |
SAB |
100ul |
EUR 252 |
NDEL1 (Phospho-Thr219) Antibody |
12766-50ul |
SAB |
50ul |
EUR 187 |
NDEL1 Blocking Peptide |
AF7025-BP |
Affbiotech |
1mg |
EUR 195 |
NDEL1 cloning plasmid |
CSB-CL872414HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1038
- Sequence: atggatggtgaagatataccagatttttcaagtttaaaggaggaaactgcttattggaaggaactttccttgaagtataagcaaagcttccaggaagctcgggatgagctagttgaattccaggaaggaagcagagaattagaagcagagttggaggcacaattagtacaggctg
- Show more
|
Description: A cloning plasmid for the NDEL1 gene. |
Mouse NDEL1 shRNA Plasmid |
20-abx979123 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Rat NDEL1 shRNA Plasmid |
20-abx987618 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NDEL1 shRNA Plasmid |
20-abx963000 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NDEL1 protein (His tag) |
80R-3923 |
Fitzgerald |
50 ug |
EUR 435 |
Description: Purified recombinant NDEL1 protein (His tag) |
NDEL1 Recombinant Protein (Human) |
RP020881 |
ABM |
100 ug |
Ask for price |
NDEL1 Recombinant Protein (Rat) |
RP213443 |
ABM |
100 ug |
Ask for price |
NDEL1 Recombinant Protein (Mouse) |
RP153371 |
ABM |
100 ug |
Ask for price |
Phospho-NDEL1 (Thr219) Blocking Peptide |
AF8492-BP |
Affbiotech |
1mg |
EUR 195 |
NDEL1 ORF Vector (Human) (pORF) |
ORF006961 |
ABM |
1.0 ug DNA |
EUR 95 |
Ndel1 ORF Vector (Rat) (pORF) |
ORF071149 |
ABM |
1.0 ug DNA |
EUR 506 |
Ndel1 ORF Vector (Mouse) (pORF) |
ORF051125 |
ABM |
1.0 ug DNA |
EUR 506 |
Rabbit Nuclear distribution protein nudE- like 1, NDEL1 ELISA KI |
ELI-36714Ra |
Lifescience Market |
96 Tests |
EUR 928 |
NudE Neurodevelopment Protein 1 Like 1 (Ndel1) Antibody |
20-abx114242 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody |
20-abx004424 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody |
20-abx321714 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody |
abx432229-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody |
20-abx241576 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody |
abx235601-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
NudE Neurodevelopment Protein 1 Like 1 (NDEL1) Antibody |
20-abx225310 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
NDEL1 sgRNA CRISPR Lentivector set (Human) |
K1406501 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ndel1 sgRNA CRISPR Lentivector set (Mouse) |
K4726801 |
ABM |
3 x 1.0 ug |
EUR 339 |
Ndel1 sgRNA CRISPR Lentivector set (Rat) |
K7045001 |
ABM |
3 x 1.0 ug |
EUR 339 |
NDEL1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1406502 |
ABM |
1.0 ug DNA |
EUR 154 |
NDEL1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1406503 |
ABM |
1.0 ug DNA |
EUR 154 |
NDEL1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1406504 |
ABM |
1.0 ug DNA |
EUR 154 |
Ndel1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4726802 |
ABM |
1.0 ug DNA |
EUR 154 |
Ndel1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K4726803 |
ABM |
1.0 ug DNA |
EUR 154 |
Ndel1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4726804 |
ABM |
1.0 ug DNA |
EUR 154 |
Ndel1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7045002 |
ABM |
1.0 ug DNA |
EUR 154 |
Ndel1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7045003 |
ABM |
1.0 ug DNA |
EUR 154 |
Ndel1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7045004 |
ABM |
1.0 ug DNA |
EUR 154 |
NDEL1 Protein Vector (Rat) (pPB-C-His) |
PV284594 |
ABM |
500 ng |
EUR 603 |
NDEL1 Protein Vector (Rat) (pPB-N-His) |
PV284595 |
ABM |
500 ng |
EUR 603 |
NDEL1 Protein Vector (Rat) (pPM-C-HA) |
PV284596 |
ABM |
500 ng |
EUR 603 |
NDEL1 Protein Vector (Rat) (pPM-C-His) |
PV284597 |
ABM |
500 ng |
EUR 603 |
NDEL1 Protein Vector (Human) (pPB-C-His) |
PV027841 |
ABM |
500 ng |
EUR 329 |
NDEL1 Protein Vector (Human) (pPB-N-His) |
PV027842 |
ABM |
500 ng |
EUR 329 |
NDEL1 Protein Vector (Human) (pPM-C-HA) |
PV027843 |
ABM |
500 ng |
EUR 329 |
NDEL1 Protein Vector (Human) (pPM-C-His) |
PV027844 |
ABM |
500 ng |
EUR 329 |
NDEL1 Protein Vector (Mouse) (pPB-C-His) |
PV204498 |
ABM |
500 ng |
EUR 603 |
NDEL1 Protein Vector (Mouse) (pPB-N-His) |
PV204499 |
ABM |
500 ng |
EUR 603 |
NDEL1 Protein Vector (Mouse) (pPM-C-HA) |
PV204500 |
ABM |
500 ng |
EUR 603 |
NDEL1 Protein Vector (Mouse) (pPM-C-His) |
PV204501 |
ABM |
500 ng |
EUR 603 |
Ndel1 3'UTR GFP Stable Cell Line |
TU163908 |
ABM |
1.0 ml |
Ask for price |
Ndel1 3'UTR Luciferase Stable Cell Line |
TU213805 |
ABM |
1.0 ml |
Ask for price |
NDEL1 3'UTR Luciferase Stable Cell Line |
TU015468 |
ABM |
1.0 ml |
EUR 1394 |
Ndel1 3'UTR Luciferase Stable Cell Line |
TU113908 |
ABM |
1.0 ml |
Ask for price |
NDEL1 3'UTR GFP Stable Cell Line |
TU065468 |
ABM |
1.0 ml |
EUR 1394 |
Ndel1 3'UTR GFP Stable Cell Line |
TU263805 |
ABM |
1.0 ml |
Ask for price |
Human Nuclear distribution protein nudE-like 1 (NDEL1) |
1-CSB-EP872414HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 65.4 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Nuclear distribution protein nudE-like 1(NDEL1) expressed in E.coli |
NDEL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV675163 |
ABM |
1.0 ug DNA |
EUR 682 |
NDEL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV675167 |
ABM |
1.0 ug DNA |
EUR 682 |
NDEL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV675168 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NDEL1 Rabbit Polyclonal Antibody