NMUR2 Rabbit Polyclonal Antibody

NMUR2 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

NMUR2 Polyclonal Antibody

ABP59482-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of NMUR2 from Human. This NMUR2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50

NMUR2 Polyclonal Antibody

46916-100ul 100ul
EUR 252

NMUR2 Polyclonal Antibody

46916-50ul 50ul
EUR 187

NMUR2 Rabbit pAb

A12812-100ul 100 ul
EUR 308

NMUR2 Rabbit pAb

A12812-200ul 200 ul
EUR 459

NMUR2 Rabbit pAb

A12812-20ul 20 ul
EUR 183

NMUR2 Rabbit pAb

A12812-50ul 50 ul
EUR 223

NMUR2 Polyclonal Conjugated Antibody

C46916 100ul
EUR 397

NMUR2 antibody

70R-5107 50 ug
EUR 467
Description: Rabbit polyclonal NMUR2 antibody raised against the N terminal of NMUR2

NMUR2 Antibody

ABD2821 100 ug
EUR 438

NMUR2 Antibody

44978-100ul 100ul
EUR 252

NMUR2 Antibody

44978-50ul 50ul
EUR 187

NMUR2 antibody

20R-NR014 50 ug
EUR 656
Description: Rabbit polyclonal NMUR2 antibody

NMUR2 antibody

70R-1539 100 ug
EUR 377
Description: Rabbit polyclonal NMUR2 antibody raised against the N terminal of NMUR2

NMUR2 Antibody

DF2821 200ul
EUR 304
Description: NMUR2 antibody detects endogenous levels of total NMUR2.

NMUR2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NMUR2. Recognizes NMUR2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

Polyclonal NMUR2 Antibody (N-Terminus)

AMM06736G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal NMUR2 antibody - N-terminal region

AMM06737G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal NMUR2 antibody - N-terminal region

AMM06738G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 - N-terminal region. This antibody is tested and proven to work in the following applications:

Nmur2/ Rat Nmur2 ELISA Kit

ELI-15102r 96 Tests
EUR 886

NMUR2 Conjugated Antibody

C44978 100ul
EUR 397

Anti-NMUR2 antibody

STJ99340 200 µl
EUR 197
Description: Rabbit polyclonal to NMUR2.

Anti-NMUR2 antibody

STJ114678 100 µl
EUR 277
Description: This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NMUR2 Blocking Peptide

33R-6432 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NMUR2 antibody, catalog no. 70R-1539

NMUR2 cloning plasmid

CSB-CL875632HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1248
  • Sequence: atgtcagggatggaaaaacttcagaatgcttcctggatctaccagcagaaactagaagatccattccagaaacacctgaacagcaccgaggagtatctggccttcctctgcggacctcggcgcagccacttcttcctccccgtgtctgtggtgtatgtgccaatttttgtggtgg
  • Show more
Description: A cloning plasmid for the NMUR2 gene.

NMUR2 cloning plasmid

CSB-CL875632HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1248
  • Sequence: atgtcagggatggaaaaacttcagaatgcttcctggatctaccagcagaaactagaagatccattccagaaacacctgaacagcaccgaggagtatctggccttcctctgcggacctcggcgcagccacttcttcctccccgtgtctgtggtgtatgtgccaatttttgtggtgg
  • Show more
Description: A cloning plasmid for the NMUR2 gene.

NMUR2 Blocking Peptide

DF2821-BP 1mg
EUR 195


PVT13972 2 ug
EUR 391

Mouse NMUR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NMUR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NMUR2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NMUR2 Recombinant Protein (Human)

RP021391 100 ug Ask for price

NMUR2 Recombinant Protein (Human)

RP021394 100 ug Ask for price

NMUR2 Recombinant Protein (Rat)

RP214145 100 ug Ask for price

NMUR2 Recombinant Protein (Mouse)

RP154454 100 ug Ask for price

Neuromedin U Receptor 2 (NMUR2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuromedin U Receptor 2 (NMUR2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rabbit Anti-Human NMU receptor 2 (NMUR2) antiserum # 1

NMUR21-S 100 ul
EUR 457

Rabbit Anti-Rat NMU receptor 2 (NMUR2) antiserum #2

NMUR22-S 100 ul
EUR 457

NMUR2 ORF Vector (Human) (pORF)

ORF007131 1.0 ug DNA
EUR 95

NMUR2 ORF Vector (Human) (pORF)

ORF007132 1.0 ug DNA
EUR 95

Nmur2 ORF Vector (Rat) (pORF)

ORF071383 1.0 ug DNA
EUR 506

Nmur2 ORF Vector (Mouse) (pORF)

ORF051486 1.0 ug DNA
EUR 506

Rabbit Anti-Human NMU receptor 2 (NMUR2) IgG # 1, aff pure

NMUR21-A 100 ug
EUR 482

Rabbit Anti-Rat NMU receptor 2 (NMUR2) IgG # 2, aff pure

NMUR22-A 100 ug
EUR 482

NMUR2 sgRNA CRISPR Lentivector set (Human)

K1437501 3 x 1.0 ug
EUR 339

Nmur2 sgRNA CRISPR Lentivector set (Mouse)

K3599401 3 x 1.0 ug
EUR 339

Nmur2 sgRNA CRISPR Lentivector set (Rat)

K7097301 3 x 1.0 ug
EUR 339

NMUR2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1437502 1.0 ug DNA
EUR 154

NMUR2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1437503 1.0 ug DNA
EUR 154

NMUR2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1437504 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3599402 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3599403 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3599404 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7097302 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7097303 1.0 ug DNA
EUR 154

Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7097304 1.0 ug DNA
EUR 154

NMUR2 Protein Vector (Human) (pPB-C-His)

PV028521 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPB-N-His)

PV028522 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPM-C-HA)

PV028523 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPM-C-His)

PV028524 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPB-C-His)

PV028525 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPB-N-His)

PV028526 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPM-C-HA)

PV028527 500 ng
EUR 329

NMUR2 Protein Vector (Human) (pPM-C-His)

PV028528 500 ng
EUR 329

NMUR2 Protein Vector (Mouse) (pPB-C-His)

PV205942 500 ng
EUR 603

NMUR2 Protein Vector (Mouse) (pPB-N-His)

PV205943 500 ng
EUR 603

NMUR2 Protein Vector (Mouse) (pPM-C-HA)

PV205944 500 ng
EUR 603

NMUR2 Protein Vector (Mouse) (pPM-C-His)

PV205945 500 ng
EUR 603

NMUR2 Protein Vector (Rat) (pPB-C-His)

PV285530 500 ng
EUR 603

NMUR2 Protein Vector (Rat) (pPB-N-His)

PV285531 500 ng
EUR 603

NMUR2 Protein Vector (Rat) (pPM-C-HA)

PV285532 500 ng
EUR 603

NMUR2 Protein Vector (Rat) (pPM-C-His)

PV285533 500 ng
EUR 603

Nmur2 3'UTR GFP Stable Cell Line

TU164181 1.0 ml Ask for price

NMUR2 3'UTR Luciferase Stable Cell Line

TU015790 1.0 ml
EUR 1394

Nmur2 3'UTR Luciferase Stable Cell Line

TU114181 1.0 ml Ask for price

NMUR2 3'UTR GFP Stable Cell Line

TU065790 1.0 ml
EUR 1394

Nmur2 3'UTR GFP Stable Cell Line

TU264055 1.0 ml Ask for price

Nmur2 3'UTR Luciferase Stable Cell Line

TU214055 1.0 ml Ask for price

Mouse Neuromedin- U receptor 2, Nmur2 ELISA KIT

ELI-45724m 96 Tests
EUR 865

Bovine Neuromedin- U receptor 2, NMUR2 ELISA KIT

ELI-39624b 96 Tests
EUR 928

Human Neuromedin- U receptor 2, NMUR2 ELISA KIT

ELI-39625h 96 Tests
EUR 824

NMUR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV695173 1.0 ug DNA
EUR 682

NMUR2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV695177 1.0 ug DNA
EUR 682

NMUR2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV695178 1.0 ug DNA
EUR 682

NMUR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV712785 1.0 ug DNA
EUR 316

NMUR2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV712789 1.0 ug DNA
EUR 316

NMUR2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV712790 1.0 ug DNA
EUR 316

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NMUR2 Rabbit Polyclonal Antibody

Back To Top