NMUR2 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
 NMUR2 Polyclonal Antibody |
|
ABP59482-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NMUR2 from Human. This NMUR2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NMUR2 protein at amino acid sequence of 1-50 |
NMUR2 Polyclonal Antibody |
|
46916-100ul |
SAB |
100ul |
EUR 252 |
NMUR2 Polyclonal Antibody |
|
46916-50ul |
SAB |
50ul |
EUR 187 |
 NMUR2 Rabbit pAb |
|
A12812-100ul |
Abclonal |
100 ul |
EUR 308 |
NMUR2 Rabbit pAb |
|
A12812-200ul |
Abclonal |
200 ul |
EUR 459 |
NMUR2 Rabbit pAb |
|
A12812-20ul |
Abclonal |
20 ul |
EUR 183 |
NMUR2 Rabbit pAb |
|
A12812-50ul |
Abclonal |
50 ul |
EUR 223 |
 NMUR2 Polyclonal Conjugated Antibody |
|
C46916 |
SAB |
100ul |
EUR 397 |
 NMUR2 antibody |
|
70R-5107 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal NMUR2 antibody raised against the N terminal of NMUR2 |
 NMUR2 Antibody |
|
44978-100ul |
SAB |
100ul |
EUR 252 |
NMUR2 Antibody |
|
44978-50ul |
SAB |
50ul |
EUR 187 |
NMUR2 antibody |
|
20R-NR014 |
Fitzgerald |
50 ug |
EUR 656 |
|
Description: Rabbit polyclonal NMUR2 antibody |
NMUR2 antibody |
|
70R-1539 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal NMUR2 antibody raised against the N terminal of NMUR2 |
NMUR2 Antibody |
|
DF2821 |
Affbiotech |
200ul |
EUR 304 |
|
Description: NMUR2 antibody detects endogenous levels of total NMUR2. |
NMUR2 Antibody |
|
1-CSB-PA135689 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against NMUR2. Recognizes NMUR2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
) Polyclonal NMUR2 Antibody (N-Terminus) |
|
AMM06736G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 (N-Terminus). This antibody is tested and proven to work in the following applications: |
 Polyclonal NMUR2 antibody - N-terminal region |
|
AMM06737G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 - N-terminal region. This antibody is tested and proven to work in the following applications: |
Polyclonal NMUR2 antibody - N-terminal region |
|
AMM06738G |
Leading Biology |
0.05mg |
EUR 528 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NMUR2 - N-terminal region. This antibody is tested and proven to work in the following applications: |
 NMUR2 Conjugated Antibody |
|
C44978 |
SAB |
100ul |
EUR 397 |
 Anti-NMUR2 antibody |
|
STJ99340 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to NMUR2. |
Anti-NMUR2 antibody |
|
STJ114678 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: This gene encodes a protein from the G-protein coupled receptor 1 family. This protein is a receptor for neuromedin U, which is a neuropeptide that is widely distributed in the gut and central nervous system. This receptor plays an important role in the regulation of food intake and body weight. |
 NMUR2 siRNA |
|
20-abx903588 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NMUR2 siRNA |
|
20-abx926087 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NMUR2 siRNA |
|
20-abx926088 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 NMUR2 Blocking Peptide |
|
33R-6432 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NMUR2 antibody, catalog no. 70R-1539 |
 NMUR2 cloning plasmid |
|
CSB-CL875632HU1-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1248
- Sequence: atgtcagggatggaaaaacttcagaatgcttcctggatctaccagcagaaactagaagatccattccagaaacacctgaacagcaccgaggagtatctggccttcctctgcggacctcggcgcagccacttcttcctccccgtgtctgtggtgtatgtgccaatttttgtggtgg
- Show more
|
|
Description: A cloning plasmid for the NMUR2 gene. |
NMUR2 cloning plasmid |
|
CSB-CL875632HU2-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1248
- Sequence: atgtcagggatggaaaaacttcagaatgcttcctggatctaccagcagaaactagaagatccattccagaaacacctgaacagcaccgaggagtatctggccttcctctgcggacctcggcgcagccacttcttcctccccgtgtctgtggtgtatgtgccaatttttgtggtgg
- Show more
|
|
Description: A cloning plasmid for the NMUR2 gene. |
NMUR2 Blocking Peptide |
|
DF2821-BP |
Affbiotech |
1mg |
EUR 195 |
 Mouse NMUR2 shRNA Plasmid |
|
20-abx981024 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat NMUR2 shRNA Plasmid |
|
20-abx986147 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human NMUR2 shRNA Plasmid |
|
20-abx961225 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) NMUR2 Recombinant Protein (Human) |
|
RP021391 |
ABM |
100 ug |
Ask for price |
NMUR2 Recombinant Protein (Human) |
|
RP021394 |
ABM |
100 ug |
Ask for price |
) NMUR2 Recombinant Protein (Rat) |
|
RP214145 |
ABM |
100 ug |
Ask for price |
) NMUR2 Recombinant Protein (Mouse) |
|
RP154454 |
ABM |
100 ug |
Ask for price |
 Antibody) Neuromedin U Receptor 2 (NMUR2) Antibody |
|
20-abx147557 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuromedin U Receptor 2 (NMUR2) Antibody |
|
20-abx324995 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 antiserum # 1) Rabbit Anti-Human NMU receptor 2 (NMUR2) antiserum # 1 |
|
NMUR21-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
 antiserum #2) Rabbit Anti-Rat NMU receptor 2 (NMUR2) antiserum #2 |
|
NMUR22-S |
Alpha Diagnostics |
100 ul |
EUR 457 |
 (pORF)) NMUR2 ORF Vector (Human) (pORF) |
|
ORF007131 |
ABM |
1.0 ug DNA |
EUR 95 |
NMUR2 ORF Vector (Human) (pORF) |
|
ORF007132 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Nmur2 ORF Vector (Rat) (pORF) |
|
ORF071383 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Nmur2 ORF Vector (Mouse) (pORF) |
|
ORF051486 |
ABM |
1.0 ug DNA |
EUR 506 |
 IgG # 1, aff pure) Rabbit Anti-Human NMU receptor 2 (NMUR2) IgG # 1, aff pure |
|
NMUR21-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
 IgG # 2, aff pure) Rabbit Anti-Rat NMU receptor 2 (NMUR2) IgG # 2, aff pure |
|
NMUR22-A |
Alpha Diagnostics |
100 ug |
EUR 482 |
) NMUR2 sgRNA CRISPR Lentivector set (Human) |
|
K1437501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nmur2 sgRNA CRISPR Lentivector set (Mouse) |
|
K3599401 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Nmur2 sgRNA CRISPR Lentivector set (Rat) |
|
K7097301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) NMUR2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1437502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) NMUR2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1437503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) NMUR2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1437504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3599402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3599403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nmur2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3599404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K7097302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K7097303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Nmur2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K7097304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) NMUR2 Protein Vector (Human) (pPB-C-His) |
|
PV028521 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) NMUR2 Protein Vector (Human) (pPB-N-His) |
|
PV028522 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) NMUR2 Protein Vector (Human) (pPM-C-HA) |
|
PV028523 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) NMUR2 Protein Vector (Human) (pPM-C-His) |
|
PV028524 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPB-C-His) |
|
PV028525 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPB-N-His) |
|
PV028526 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPM-C-HA) |
|
PV028527 |
ABM |
500 ng |
EUR 329 |
NMUR2 Protein Vector (Human) (pPM-C-His) |
|
PV028528 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) NMUR2 Protein Vector (Mouse) (pPB-C-His) |
|
PV205942 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NMUR2 Protein Vector (Mouse) (pPB-N-His) |
|
PV205943 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NMUR2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV205944 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NMUR2 Protein Vector (Mouse) (pPM-C-His) |
|
PV205945 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) NMUR2 Protein Vector (Rat) (pPB-C-His) |
|
PV285530 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) NMUR2 Protein Vector (Rat) (pPB-N-His) |
|
PV285531 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) NMUR2 Protein Vector (Rat) (pPM-C-HA) |
|
PV285532 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) NMUR2 Protein Vector (Rat) (pPM-C-His) |
|
PV285533 |
ABM |
500 ng |
EUR 603 |
 Nmur2 3'UTR GFP Stable Cell Line |
|
TU164181 |
ABM |
1.0 ml |
Ask for price |
 NMUR2 3'UTR Luciferase Stable Cell Line |
|
TU015790 |
ABM |
1.0 ml |
EUR 1394 |
 Nmur2 3'UTR Luciferase Stable Cell Line |
|
TU114181 |
ABM |
1.0 ml |
Ask for price |
 NMUR2 3'UTR GFP Stable Cell Line |
|
TU065790 |
ABM |
1.0 ml |
EUR 1394 |
Nmur2 3'UTR GFP Stable Cell Line |
|
TU264055 |
ABM |
1.0 ml |
Ask for price |
Nmur2 3'UTR Luciferase Stable Cell Line |
|
TU214055 |
ABM |
1.0 ml |
Ask for price |
 Mouse Neuromedin- U receptor 2, Nmur2 ELISA KIT |
|
ELI-45724m |
Lifescience Market |
96 Tests |
EUR 865 |
 Bovine Neuromedin- U receptor 2, NMUR2 ELISA KIT |
|
ELI-39624b |
Lifescience Market |
96 Tests |
EUR 928 |
 Human Neuromedin- U receptor 2, NMUR2 ELISA KIT |
|
ELI-39625h |
Lifescience Market |
96 Tests |
EUR 824 |
 (CMV) (pLenti-GIII-CMV)) NMUR2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
|
LV695173 |
ABM |
1.0 ug DNA |
EUR 682 |
 (UbC) (pLenti-GIII-UbC)) NMUR2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
|
LV695177 |
ABM |
1.0 ug DNA |
EUR 682 |
 (EF1a) (pLenti-GIII-EF1a)) NMUR2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
|
LV695178 |
ABM |
1.0 ug DNA |
EUR 682 |
 (CMV) (pLenti-GIII-CMV)) NMUR2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
|
LV712785 |
ABM |
1.0 ug DNA |
EUR 316 |
 (UbC) (pLenti-GIII-UbC)) NMUR2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
|
LV712789 |
ABM |
1.0 ug DNA |
EUR 316 |
 (EF1a) (pLenti-GIII-EF1a)) NMUR2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
|
LV712790 |
ABM |
1.0 ug DNA |
EUR 316 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
|
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4a Rabbit Polyclonal Antibody |
|
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
|
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4b Rabbit Polyclonal Antibody |
|
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
|
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG4c Rabbit Polyclonal Antibody |
|
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
|
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG5 Rabbit Polyclonal Antibody |
|
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
|
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG7 Rabbit Polyclonal Antibody |
|
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
|
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATG13 Rabbit Polyclonal Antibody |
|
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NMUR2 Rabbit Polyclonal Antibody
