NNT-1 Rabbit Polyclonal Antibody

NNT-1 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

NNT-1 Polyclonal Antibody
46837-50ul 50ul
EUR 187
NNT-1 Polyclonal Antibody
ABP59483-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NNT-1 protein at amino acid sequence of 171-220
  • Applications tips:
Description: A polyclonal antibody for detection of NNT-1 from Human, Mouse, Rat. This NNT-1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NNT-1 protein at amino acid sequence of 171-220
NNT-1 Polyclonal Antibody
ABP59483-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NNT-1 protein at amino acid sequence of 171-220
  • Applications tips:
Description: A polyclonal antibody for detection of NNT-1 from Human, Mouse, Rat. This NNT-1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NNT-1 protein at amino acid sequence of 171-220
NNT-1 Polyclonal Antibody
ABP59483-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NNT-1 protein at amino acid sequence of 171-220
  • Applications tips:
Description: A polyclonal antibody for detection of NNT-1 from Human, Mouse, Rat. This NNT-1 antibody is for IHC-P, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NNT-1 protein at amino acid sequence of 171-220
NNT-1 Polyclonal Antibody
ES8714-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NNT-1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA
NNT-1 Polyclonal Antibody
ES8714-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NNT-1 from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA
NNT Rabbit pAb
A4561-100ul 100 ul
EUR 308
NNT Rabbit pAb
A4561-200ul 200 ul
EUR 459
NNT Rabbit pAb
A4561-20ul 20 ul
EUR 183
NNT Rabbit pAb
A4561-50ul 50 ul
EUR 223
Anti-NNT-1 Antibody
A08886 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NNT-1 Antibody (CLCF1) detection.tested for IHC in Human, Mouse, Rat.
Anti-NNT-1 antibody
STJ98777 200 µl
EUR 197
Description: Rabbit polyclonal to NNT-1.
NNT antibody
70R-18910 50 ul
EUR 435
Description: Rabbit polyclonal NNT antibody
NNT Antibody
46069-100ul 100ul
EUR 252
NNT Antibody
46069-50ul 50ul
EUR 187
NNT Antibody
DF9658 200ul
EUR 304
Description: NNT Antibody detects endogenous levels of total NNT.
NNT Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NNT. Recognizes NNT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
NNT antibody
70R-6519 50 ug
EUR 467
Description: Rabbit polyclonal NNT antibody raised against the N terminal of NNT
NNT antibody
70R-51371 100 ul
EUR 244
Description: Purified Polyclonal NNT antibody
NNT Antibody
ABD9658 100 ug
EUR 438
NNT-1/BSF-3 antibody
22627-100ul 100ul
EUR 390
Polyclonal NNT antibody - N-terminal region
APR08764G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NNT - N-terminal region. This antibody is tested and proven to work in the following applications:
NNT Conjugated Antibody
C46069 100ul
EUR 397
anti- NNT antibody
FNab05775 100µg
EUR 505.25
  • Immunogen: nicotinamide nucleotide transhydrogenase
  • Uniprot ID: Q13423
  • Gene ID: 23530
  • Research Area: Metabolism
Description: Antibody raised against NNT
Anti-NNT antibody
PAab05775 100 ug
EUR 355
Anti-NNT antibody
STJ116248 100 µl
EUR 277
Description: This gene encodes an integral protein of the inner mitochondrial membrane. The enzyme couples hydride transfer between NAD(H) and NADP(+) to proton translocation across the inner mitochondrial membrane. Under most physiological conditions, the enzyme uses energy from the mitochondrial proton gradient to produce high concentrations of NADPH. The resulting NADPH is used for biosynthesis and in free radical detoxification.
Human Novel Neurotrophin-1 (NNT-1) Antibody
32208-05111 150 ug
EUR 261
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
YF-PA17929 50 ul
EUR 363
Description: Mouse polyclonal to NNT
YF-PA17930 100 ug
EUR 403
Description: Rabbit polyclonal to NNT
NNT Blocking Peptide
33R-4206 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NNT antibody, catalog no. 70R-6519
NNT Blocking Peptide
DF9658-BP 1mg
EUR 195
NNT Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
NNT cloning plasmid
CSB-CL615685HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atgaatcgctccctggctaatgtgattcttggaggctatggcaccacttcaacagctggtggaaaacccatggaaatttctggcacacatacggaaatcaaccttgacaatgcaattgacatgattcgagaagctaatagcattattattacaccaggctatggtctctgtgcagc
  • Show more
Description: A cloning plasmid for the NNT gene.
NNT cloning plasmid
CSB-CL615685HU2-10ug 10ug
EUR 1164
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3261
  • Show more
Description: A cloning plasmid for the NNT gene.
Anti-NNT (1D6)
YF-MA17921 100 ug
EUR 363
Description: Mouse monoclonal to NNT
Nicotinamide Nucleotide Transhydrogenase (NNT) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Nicotinamide Nucleotide Transhydrogenase (NNT) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Nicotinamide Nucleotide Transhydrogenase (NNT) Antibody
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Nicotinamide Nucleotide Transhydrogenase (NNT) Antibody
abx146315-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Nicotinamide Nucleotide Transhydrogenase (NNT) Antibody
abx235775-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Human Novel Neurotrophin-1 (NNT-1) Antibody (Biotin Conjugate)
32208-05121 150 ug
EUR 369
NNT-1/BCSF-3, Human Recombinant
EUR 370
NNT-1/BCSF-3, Human Recombinant
EUR 175
Rabbit Polyclonal Antibody to Human Topoisomerase IIα
TG2011-1 250 units
EUR 414
Polyclonal Rabbit anti-sEH
SEH-1 50 uL
EUR 280
Anti-Sumo 1 Rabbit Monoclonal Antibody
M00631-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Sumo 1 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-Cytokeratin 1 Rabbit Monoclonal Antibody
M01639-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Cytokeratin 1 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Human Novel Neurotrophin-1 (NNT-1) AssayLite Antibody (FITC Conjugate)
32208-05141 150 ug
EUR 428
Human Novel Neurotrophin-1 (NNT-1) AssayLite Antibody (RPE Conjugate)
32208-05151 150 ug
EUR 428
Human Novel Neurotrophin-1 (NNT-1) AssayLite Antibody (APC Conjugate)
32208-05161 150 ug
EUR 428
Human Novel Neurotrophin-1 (NNT-1) AssayLite Antibody (PerCP Conjugate)
32208-05171 150 ug
EUR 471
EF001268 96 Tests
EUR 689
Human NNT shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Nnt sgRNA CRISPR Lentivector (Rat) (Target 1)
K7240302 1.0 ug DNA
EUR 154
Nnt sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3859002 1.0 ug DNA
EUR 154
NNT sgRNA CRISPR Lentivector (Human) (Target 1)
K1437902 1.0 ug DNA
EUR 154
Recombinant Human NNT-1/BCSF-3 Protein
PROTQ9UBD9-2 10ug
EUR 317
Description: NNT-1/BCSF-3 is a neurotrophic factor with B-cell stimulating capabilities. Expressed in lymph nodes and spleen, NNT-1/BCSF-3 binds and activates glycoprotein 130 (gp130) and leukemia inhibitory factor receptor member β (LIFR-β) and induces tyrosine phosphorylation of these receptors. In vitro, it supports the survival of chick embryo motor and sympathetic neurons. In mice, NNT-1/BCSF-3 induces serum amyloid A, causes body weight loss and B cell hyperplasia associated with increased in serum IgG and IgM. Recombinant human NNT-1/BCSF-3 is a 22.4 kDa protein containing 199 amino acid residues.
Anti-HMGB1/Hmg 1 Rabbit Monoclonal Antibody
M00066-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal HMGB1/Hmg 1 Antibody. Validated in Flow Cytometry, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Anti-p27 KIP 1 Rabbit Monoclonal Antibody
M00173-1 100ug/vial
EUR 397
Description: Anti-p27 KIP 1 Rabbit Monoclonal Antibody tested for Flow Cytometry, IP, IF, IHC, ICC, WB in Human, Rat
Anti-MHC class 1 Rabbit Monoclonal Antibody
M00194-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal MHC class 1 Antibody. Validated in IP, IF, IHC, WB and tested in Human.
Anti-Integrin beta 1 Rabbit Monoclonal Antibody
M00772-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Integrin beta 1 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-ARG1/Arginase 1 Rabbit Monoclonal Antibody
M01106-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal ARG1/Arginase 1 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
Anti-MLANA/Mart 1 Rabbit Monoclonal Antibody
M02033-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal MLANA/Mart 1 Antibody. Validated in IF, WB and tested in Human.
Anti-DSG1/Desmoglein 1 Rabbit Monoclonal Antibody
M02655-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal DSG1/Desmoglein 1 Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Anti-BOB-1/OBF-1 Rabbit Monoclonal Antibody, Clone#RM378
M04431-1 100uL
EUR 385
Description: Anti-BOB-1/OBF-1 Rabbit Monoclonal Antibody, Clone#RM378 tested in WB, IHC, reactive to Human
Anti-AFP/Alpha 1 Fetoprotein Rabbit Monoclonal Antibody
M00522-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal AFP/Alpha 1 Fetoprotein Antibody. Validated in IP, IF, WB and tested in Human.
Anti-SERPINA1/Alpha 1 Antitrypsin Rabbit Monoclonal Antibody
M00720-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal SERPINA1/Alpha 1 Antitrypsin Antibody. Validated in IP, IF, WB and tested in Human.
Anti-GPX1/Glutathione Peroxidase 1 Rabbit Monoclonal Antibody
M01019-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal GPX1/Glutathione Peroxidase 1 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
Anti-BAG-1 Rabbit Monoclonal Antibody, Clone#RM356
M02423-1 100uL
EUR 385
Description: Anti-BAG-1 Rabbit Monoclonal Antibody, Clone#RM356 tested in WB, IHC, reactive to Human
Monoclonal NNT Antibody (monoclonal) (M01), Clone: 1D6
APR08763G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NNT (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D6. This antibody is applicable in WB and IF, E
Nnt ORF Vector (Rat) (pORF)
ORF071387 1.0 ug DNA
EUR 506
NNT ORF Vector (Human) (pORF)
ORF013893 1.0 ug DNA
EUR 354
NNT ORF Vector (Human) (pORF)
ORF007135 1.0 ug DNA
EUR 95
Nnt ORF Vector (Mouse) (pORF)
ORF051490 1.0 ug DNA
EUR 506
Anti-Phospho-AMPK alpha 1 (S496) Rabbit Monoclonal Antibody
P00994-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-AMPK alpha 1 (S496) Antibody. Validated in IP, IF, WB and tested in Human.
Helicobacter Pylori; Rabbit Polyclonal (Concentrate)
RA0379-C.1 0.1 ml
EUR 125
Cyclooxygenase 1 Rabbit Polyclonal Antibody
38023-100ul 100ul
EUR 252
Cyclooxygenase 1 Rabbit Polyclonal Antibody
38023-50ul 50ul
EUR 187
Rabbit polyclonal METTL8(1) antibody
40013-100ul 100ul
EUR 390
IGFBP-1 Polyclonal Antibody (Rabbit)
PAAH1 200 µg
EUR 299
Anti-HIF-1 alpha (HIF1A) Rabbit Monoclonal Antibody, Clone#RM242
M00013-1 100ul
EUR 375
Description: Anti-HIF-1 alpha (HIF1A) Rabbit Monoclonal Antibody, Clone#RM242 tested in WB, IHC, reactive to Human
Anti-CETP Antibody (polyclonal rabbit anti-human, mouse, rat) with goat anti-rabbit HRP secondary antibody
EXOAB-CETP-1 25 ul
EUR 219
Nnt sgRNA CRISPR Lentivector set (Rat)
K7240301 3 x 1.0 ug
EUR 339
Nnt sgRNA CRISPR Lentivector set (Mouse)
K3859001 3 x 1.0 ug
EUR 339
NNT sgRNA CRISPR Lentivector set (Human)
K1437901 3 x 1.0 ug
EUR 339
beta-Catenin (p120); Rabbit Polyclonal (Concentrate)
RA0104-C.1 0.1 ml
EUR 125
Anti-p53 Rabbit Monoclonal Antibody
M00001-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal p53 Antibody. Validated in IP, IF, WB and tested in Human.
Anti-PTEN Rabbit Monoclonal Antibody
M00006-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal PTEN Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-STAT3 Rabbit Monoclonal Antibody
M00007-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT3 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-BDNF Rabbit Monoclonal Antibody
M00035-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal BDNF Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-STAT1 Rabbit Monoclonal Antibody
M00036-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT1 Antibody. Validated in IP, WB and tested in Human, Mouse.
Anti-VEGF Rabbit Monoclonal Antibody
M00045-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal VEGF Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC and tested in Human, Mouse.
Anti-CD44 Rabbit Monoclonal Antibody
M00052-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD44 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.
Anti-Insulin Rabbit Monoclonal Antibody
M00067-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Insulin Antibody. Validated in IHC and tested in Human, Mouse, Rat.
Anti-Rad51 Rabbit Monoclonal Antibody
M00088-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Rad51 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-Smad2 Rabbit Monoclonal Antibody
M00090-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Smad2 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-Tau Rabbit Monoclonal Antibody
M00097-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Tau Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-SOX2 Rabbit Monoclonal Antibody
M00105-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal SOX2 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.
Anti-Src Rabbit Monoclonal Antibody
M00107-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Src Antibody. Validated in IF, WB and tested in Human, Rat.
Anti-PCNA Rabbit Monoclonal Antibody
M00125-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal PCNA Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Anti-CD11b Rabbit Monoclonal Antibody
M00144-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD11b Antibody. Validated in IF, IHC, ICC, WB and tested in Human, Mouse.
Anti-SHP2 Rabbit Monoclonal Antibody
M00150-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal SHP2 Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.
Anti-CD19 Rabbit Monoclonal Antibody
M00154-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD19 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-CDK4 Rabbit Monoclonal Antibody
M00159-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CDK4 Antibody. Validated in IF, WB and tested in Human.
Anti-p63 Rabbit Monoclonal Antibody
M00167-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal p63 Antibody. Validated in Flow Cytometry, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Anti-PD1 Rabbit Monoclonal Antibody
M00178-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal PD1 Antibody. Validated in IHC and tested in Human.
Anti-Bax Rabbit Monoclonal Antibody
M00183-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Bax Antibody. Validated in IP, IHC, WB and tested in Human, Mouse, Rat.
Anti-NCAM Rabbit Monoclonal Antibody
M00184-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal NCAM Antibody. Validated in IP, IF, WB and tested in Human.
Anti-TRAF6 Rabbit Monoclonal Antibody
M00185-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal TRAF6 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-MUC1 Rabbit Monoclonal Antibody
M00187-1 100ug/vial
EUR 397
Description: Anti-MUC1 Rabbit Monoclonal Antibody tested for Flow Cytometry, IP, IF, IHC, ICC, WB in Human
Anti-FGFR3 Rabbit Monoclonal Antibody
M00200-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal FGFR3 Antibody. Validated in IF, WB and tested in Human.
Anti-GFAP Rabbit Monoclonal Antibody
M00213-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal GFAP Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Anti-LRRK2 Rabbit Monoclonal Antibody
M00221-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal LRRK2 Antibody. Validated in IF, WB and tested in Human, Mouse.
Anti-GAPDH Rabbit Monoclonal Antibody
M00227-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal GAPDH Antibody. Validated in Flow Cytometry, IF, IHC, ICC, WB and tested in Canine, Chicken, Cow, Human, Monkey, Mouse, Rat.
Anti-Vimentin Rabbit Monoclonal Antibody
M00235-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Vimentin Antibody. Validated in IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-CD147 Rabbit Monoclonal Antibody
M00248-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD147 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-FoxO3a Rabbit Monoclonal Antibody
M00252-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal FoxO3a Antibody. Validated in IF, IHC, WB and tested in Human.
Anti-MMP2 Rabbit Monoclonal Antibody
M00286-1 100ug/vial
EUR 397
Description: Anti-MMP2 Rabbit Monoclonal Antibody tested for IHC-P, WB in Human, Mouse, Rat.
Anti-Tyrosinase Rabbit Monoclonal Antibody
M00326-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Tyrosinase Antibody. Validated in IF, WB and tested in Human.
Anti-CD11c Rabbit Monoclonal Antibody
M00357-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD11c Antibody. Validated in IP, IF, IHC, ICC, WB and tested in Human.
Anti-CD46 Rabbit Monoclonal Antibody
M00377-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD46 Antibody. Validated in IF, IHC, WB and tested in Human.
Anti-Survivin Rabbit Monoclonal Antibody
M00379-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Survivin Antibody. Validated in IP, IF, IHC, WB and tested in Human.
Anti-S100A9 Rabbit Monoclonal Antibody
M00380-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal S100A9 Antibody. Validated in IF and tested in Human.
Anti-FLI1 Rabbit Monoclonal Antibody
M00399-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal FLI1 Antibody. Validated in IHC, WB and tested in Human, Mouse.
Anti-MRP8 Rabbit Monoclonal Antibody
M00413-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal MRP8 Antibody. Validated in IP, IHC, WB and tested in Human, Mouse.
Anti-Raf1 Rabbit Monoclonal Antibody
M00446-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Raf1 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-GATA4 Rabbit Monoclonal Antibody
M00499-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal GATA4 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-STAT6 Rabbit Monoclonal Antibody
M00523-1 100ug/vial
EUR 397
Description: Anti-STAT6 Rabbit Monoclonal Antibodytested for Flow Cytometry, IF, ICC, WB in Human
Anti-CD45 Rabbit Monoclonal Antibody
M00555-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD45 Antibody. Validated in IHC, WB and tested in Human.
Anti-TIMP1 Rabbit Monoclonal Antibody
M00561-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal TIMP1 Antibody. Validated in WB and tested in Human.
Anti-Fibronectin Rabbit Monoclonal Antibody
M00564-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Fibronectin Antibody. Validated in IHC, ICC and tested in Human.
Anti-GLP1 Rabbit Monoclonal Antibody
M00678-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal GLP1 Antibody. Validated in IF, WB and tested in Human.
Anti-TrkA Rabbit Monoclonal Antibody
M00706-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal TrkA Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
Anti-Smad1 Rabbit Monoclonal Antibody
M00728-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Smad1 Antibody. Validated in IF, IHC, WB and tested in Human, Mouse.
Anti-SOX10 Rabbit Monoclonal Antibody
M00758-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal SOX10 Antibody. Validated in IF, WB and tested in Human, Mouse, Rat.
Anti-Moesin Rabbit Monoclonal Antibody
M00766-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Moesin Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-RelB Rabbit Monoclonal Antibody
M00836-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal RelB Antibody. Validated in IP, IF, WB and tested in Human.
Anti-PAX7 Rabbit Monoclonal Antibody
M00845-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal PAX7 Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-MRP1 Rabbit Monoclonal Antibody
M00872-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal MRP1 Antibody. Validated in WB and tested in Human.
Anti-CDX2 Rabbit Monoclonal Antibody
M00877-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CDX2 Antibody. Validated in IF, IHC, WB and tested in Human.
Anti-CD34 Rabbit Monoclonal Antibody
M00885-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD34 Antibody. Validated in IP, IF, IHC, WB and tested in Human, Mouse, Rat.
Anti-CD59 Rabbit Monoclonal Antibody
M00914-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD59 Antibody. Validated in IP, IF, WB and tested in Human.
Anti-IRF5 Rabbit Monoclonal Antibody
M00958-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal IRF5 Antibody. Validated in WB and tested in Human.
Anti-PGP9.5 Rabbit Monoclonal Antibody
M01018-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal PGP9.5 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-PMS2 Rabbit Monoclonal Antibody
M01028-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal PMS2 Antibody. Validated in IP, IF, IHC, WB and tested in Human.
Anti-TIMP2 Rabbit Monoclonal Antibody
M01037-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal TIMP2 Antibody. Validated in Flow Cytometry and tested in Human.
Anti-Chk1 Rabbit Monoclonal Antibody
M01060-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Chk1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-CD63 Rabbit Monoclonal Antibody
M01080-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal CD63 Antibody. Validated in IHC, WB and tested in Human.
Anti-STAT5a Rabbit Monoclonal Antibody
M01087-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal STAT5a Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.
Anti-Podoplanin Rabbit Monoclonal Antibody
M01124-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal Podoplanin Antibody. Validated in WB and tested in Human, Mouse, Rat.
Anti-MUC2 Rabbit Monoclonal Antibody
M01212-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal MUC2 Antibody. Validated in IP, IF, WB and tested in Human, Rat.
Anti-S100A4 Rabbit Monoclonal Antibody
M01217-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal S100A4 Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

NNT-1 Rabbit Polyclonal Antibody

Back To Top