NR2C1 Rabbit Polyclonal Antibody

NR2C1 Rabbit Polyclonal Antibody

To Order:

NR2C1 Polyclonal Antibody

ABP59524-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NR2C1 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of NR2C1 from Human, Mouse, Rat. This NR2C1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR2C1 protein at amino acid sequence of 40-120

NR2C1 Polyclonal Antibody

42274-100ul 100ul
EUR 333

NR2C1 Rabbit pAb

A6675-100ul 100 ul
EUR 308

NR2C1 Rabbit pAb

A6675-200ul 200 ul
EUR 459

NR2C1 Rabbit pAb

A6675-20ul 20 ul
EUR 183

NR2C1 Rabbit pAb

A6675-50ul 50 ul
EUR 223

NR2C1 Polyclonal Conjugated Antibody

C42274 100ul
EUR 397

NR2C1 Antibody

ABD8785 100 ug
EUR 438

NR2C1 antibody

10R-1525 100 ug
EUR 512
Description: Mouse monoclonal NR2C1 antibody

NR2C1 antibody

20R-2871 100 ul
EUR 349
Description: Rabbit polyclonal NR2C1 antibody

NR2C1 antibody

70R-18952 50 ul
EUR 435
Description: Rabbit polyclonal NR2C1 antibody

NR2C1 Antibody

DF8785 200ul
EUR 304
Description: NR2C1 Antibody detects endogenous levels of total NR2C1.

NR2C1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

NR2C1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NR2C1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Nr2c1/ Rat Nr2c1 ELISA Kit

ELI-46138r 96 Tests
EUR 886

anti- NR2C1 antibody

FNab05840 100µg
EUR 505.25
  • Immunogen: nuclear receptor subfamily 2, group C, member 1
  • Uniprot ID: P13056
  • Gene ID: 7181
  • Research Area: Signal Transduction, Metabolism, Developmental biology
Description: Antibody raised against NR2C1

Anti-NR2C1 antibody

PAab05840 100 ug
EUR 355

Anti-NR2C1 antibody

STJ28758 100 µl
EUR 277
Description: This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined.

Anti-NR2C1 antibody

STJ190193 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NR2C1


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NR2C1 cloning plasmid

CSB-CL016051HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1404
  • Sequence: atggcaaccatagaagaaattgcacatcaaattattgaacaacagatgggagagattgttacagagcagcaaactgggcagaaaatccagattgtgacagcacttgatcataatacccaaggcaagcagttcattctgacaaatcacgacggctctactccaagcaaagtcattc
  • Show more
Description: A cloning plasmid for the NR2C1 gene.

NR2C1 Blocking Peptide

DF8785-BP 1mg
EUR 195

Rat NR2C1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-13315h 96 Tests
EUR 824

Mouse Nr2c1 ELISA KIT

ELI-21287m 96 Tests
EUR 865


EF001316 96 Tests
EUR 689


ELI-46137b 96 Tests
EUR 928

Human NR2C1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NR2C1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NR2C1 Recombinant Protein (Human)

RP021604 100 ug Ask for price

NR2C1 Recombinant Protein (Rat)

RP214454 100 ug Ask for price

NR2C1 Recombinant Protein (Mouse)

RP154889 100 ug Ask for price

NR2C1 ORF Vector (Human) (pORF)

ORF007202 1.0 ug DNA
EUR 95

Nr2c1 ORF Vector (Rat) (pORF)

ORF071486 1.0 ug DNA
EUR 506

Nr2c1 ORF Vector (Mouse) (pORF)

ORF051631 1.0 ug DNA
EUR 506

NR2C1 sgRNA CRISPR Lentivector set (Human)

K1452101 3 x 1.0 ug
EUR 339

Nr2c1 sgRNA CRISPR Lentivector set (Mouse)

K3814201 3 x 1.0 ug
EUR 339

Nr2c1 sgRNA CRISPR Lentivector set (Rat)

K7368101 3 x 1.0 ug
EUR 339

NR2C1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1452102 1.0 ug DNA
EUR 154

NR2C1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1452103 1.0 ug DNA
EUR 154

NR2C1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1452104 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3814202 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3814203 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3814204 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7368102 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7368103 1.0 ug DNA
EUR 154

Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7368104 1.0 ug DNA
EUR 154

NR2C1 Protein Vector (Human) (pPB-C-His)

PV028805 500 ng
EUR 329

NR2C1 Protein Vector (Human) (pPB-N-His)

PV028806 500 ng
EUR 329

NR2C1 Protein Vector (Human) (pPM-C-HA)

PV028807 500 ng
EUR 329

NR2C1 Protein Vector (Human) (pPM-C-His)

PV028808 500 ng
EUR 329

NR2C1 Protein Vector (Mouse) (pPB-C-His)

PV206522 500 ng
EUR 603

NR2C1 Protein Vector (Mouse) (pPB-N-His)

PV206523 500 ng
EUR 603

NR2C1 Protein Vector (Mouse) (pPM-C-HA)

PV206524 500 ng
EUR 603

NR2C1 Protein Vector (Mouse) (pPM-C-His)

PV206525 500 ng
EUR 603

NR2C1 Protein Vector (Rat) (pPB-C-His)

PV285942 500 ng
EUR 603

NR2C1 Protein Vector (Rat) (pPB-N-His)

PV285943 500 ng
EUR 603

NR2C1 Protein Vector (Rat) (pPM-C-HA)

PV285944 500 ng
EUR 603

NR2C1 Protein Vector (Rat) (pPM-C-His)

PV285945 500 ng
EUR 603

Nr2c1 3'UTR GFP Stable Cell Line

TU164293 1.0 ml Ask for price

NR2C1 3'UTR Luciferase Stable Cell Line

TU015939 1.0 ml
EUR 1521

Nr2c1 3'UTR Luciferase Stable Cell Line

TU114293 1.0 ml Ask for price

NR2C1 3'UTR GFP Stable Cell Line

TU065939 1.0 ml
EUR 1521

Nr2c1 3'UTR GFP Stable Cell Line

TU264163 1.0 ml Ask for price

Nr2c1 3'UTR Luciferase Stable Cell Line

TU214163 1.0 ml Ask for price

Nuclear Receptor Subfamily 2, Group C, Member 1 (NR2C1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody

abx122665-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody

abx028626-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody

abx028626-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody

  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody

abx235840-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NR2C1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV666865 1.0 ug DNA
EUR 682

NR2C1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV666869 1.0 ug DNA
EUR 682

NR2C1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV666870 1.0 ug DNA
EUR 682

VEGF Rabbit Polyclonal Antibody

ES8453-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody

ES8453-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody

ES8454-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody

ES8455-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8456-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody

ES8457-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody

ES8558-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody

ES8559-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody

ES8560-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody

ES8561-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody

ES8562-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody

ES8563-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody

ES8564-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody

ES8565-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody

ES8566-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody

ES8567-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody

ES8568-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody

ES8569-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody

ES8570-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody

ES8571-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody

ES8572-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody

ES8573-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8574-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody

ES8575-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody

ES8576-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8578-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody

ES8579-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NR2C1 Rabbit Polyclonal Antibody

Back To Top