NR2C1 Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
NR2C1 Polyclonal Antibody |
ABP59524-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NR2C1 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of NR2C1 from Human, Mouse, Rat. This NR2C1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NR2C1 protein at amino acid sequence of 40-120 |
NR2C1 Polyclonal Antibody |
42274-100ul |
SAB |
100ul |
EUR 333 |
NR2C1 Rabbit pAb |
A6675-100ul |
Abclonal |
100 ul |
EUR 308 |
NR2C1 Rabbit pAb |
A6675-200ul |
Abclonal |
200 ul |
EUR 459 |
NR2C1 Rabbit pAb |
A6675-20ul |
Abclonal |
20 ul |
EUR 183 |
NR2C1 Rabbit pAb |
A6675-50ul |
Abclonal |
50 ul |
EUR 223 |
NR2C1 Polyclonal Conjugated Antibody |
C42274 |
SAB |
100ul |
EUR 397 |
NR2C1 antibody |
10R-1525 |
Fitzgerald |
100 ug |
EUR 512 |
Description: Mouse monoclonal NR2C1 antibody |
NR2C1 antibody |
20R-2871 |
Fitzgerald |
100 ul |
EUR 349 |
Description: Rabbit polyclonal NR2C1 antibody |
NR2C1 antibody |
70R-18952 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NR2C1 antibody |
NR2C1 Antibody |
DF8785 |
Affbiotech |
200ul |
EUR 304 |
Description: NR2C1 Antibody detects endogenous levels of total NR2C1. |
NR2C1 Antibody |
1-CSB-PA016051ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
NR2C1 Antibody |
1-CSB-PA016051ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NR2C1 Antibody |
1-CSB-PA016051GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NR2C1. Recognizes NR2C1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
anti- NR2C1 antibody |
FNab05840 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: nuclear receptor subfamily 2, group C, member 1
- Uniprot ID: P13056
- Gene ID: 7181
- Research Area: Signal Transduction, Metabolism, Developmental biology
|
Description: Antibody raised against NR2C1 |
Anti-NR2C1 antibody |
STJ28758 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a nuclear hormone receptor characterized by a highly conserved DNA binding domain (DBD), a variable hinge region, and a carboxy-terminal ligand binding domain (LBD) that is typical for all members of the steroid/thyroid hormone receptor superfamily. This protein also belongs to a large family of ligand-inducible transcription factors that regulate gene expression by binding to specific DNA sequences within promoters of target genes. Multiple alternatively spliced transcript variants have been described, but the full-length nature of some of these variants has not been determined. |
Anti-NR2C1 antibody |
STJ190193 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NR2C1 |
NR2C1 siRNA |
20-abx903646 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR2C1 siRNA |
20-abx926331 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR2C1 siRNA |
20-abx926332 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NR2C1 cloning plasmid |
CSB-CL016051HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1404
- Sequence: atggcaaccatagaagaaattgcacatcaaattattgaacaacagatgggagagattgttacagagcagcaaactgggcagaaaatccagattgtgacagcacttgatcataatacccaaggcaagcagttcattctgacaaatcacgacggctctactccaagcaaagtcattc
- Show more
|
Description: A cloning plasmid for the NR2C1 gene. |
NR2C1 Blocking Peptide |
DF8785-BP |
Affbiotech |
1mg |
EUR 195 |
Rat NR2C1 shRNA Plasmid |
20-abx988029 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NR2C1 shRNA Plasmid |
20-abx954931 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NR2C1 shRNA Plasmid |
20-abx973202 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NR2C1 Recombinant Protein (Human) |
RP021604 |
ABM |
100 ug |
Ask for price |
NR2C1 Recombinant Protein (Rat) |
RP214454 |
ABM |
100 ug |
Ask for price |
NR2C1 Recombinant Protein (Mouse) |
RP154889 |
ABM |
100 ug |
Ask for price |
NR2C1 ORF Vector (Human) (pORF) |
ORF007202 |
ABM |
1.0 ug DNA |
EUR 95 |
Nr2c1 ORF Vector (Rat) (pORF) |
ORF071486 |
ABM |
1.0 ug DNA |
EUR 506 |
Nr2c1 ORF Vector (Mouse) (pORF) |
ORF051631 |
ABM |
1.0 ug DNA |
EUR 506 |
NR2C1 sgRNA CRISPR Lentivector set (Human) |
K1452101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr2c1 sgRNA CRISPR Lentivector set (Mouse) |
K3814201 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nr2c1 sgRNA CRISPR Lentivector set (Rat) |
K7368101 |
ABM |
3 x 1.0 ug |
EUR 339 |
NR2C1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1452102 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C1 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1452103 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C1 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1452104 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K3814202 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3814203 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K3814204 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7368102 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7368103 |
ABM |
1.0 ug DNA |
EUR 154 |
Nr2c1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7368104 |
ABM |
1.0 ug DNA |
EUR 154 |
NR2C1 Protein Vector (Human) (pPB-C-His) |
PV028805 |
ABM |
500 ng |
EUR 329 |
NR2C1 Protein Vector (Human) (pPB-N-His) |
PV028806 |
ABM |
500 ng |
EUR 329 |
NR2C1 Protein Vector (Human) (pPM-C-HA) |
PV028807 |
ABM |
500 ng |
EUR 329 |
NR2C1 Protein Vector (Human) (pPM-C-His) |
PV028808 |
ABM |
500 ng |
EUR 329 |
NR2C1 Protein Vector (Mouse) (pPB-C-His) |
PV206522 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Mouse) (pPB-N-His) |
PV206523 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Mouse) (pPM-C-HA) |
PV206524 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Mouse) (pPM-C-His) |
PV206525 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Rat) (pPB-C-His) |
PV285942 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Rat) (pPB-N-His) |
PV285943 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Rat) (pPM-C-HA) |
PV285944 |
ABM |
500 ng |
EUR 603 |
NR2C1 Protein Vector (Rat) (pPM-C-His) |
PV285945 |
ABM |
500 ng |
EUR 603 |
Nr2c1 3'UTR GFP Stable Cell Line |
TU164293 |
ABM |
1.0 ml |
Ask for price |
NR2C1 3'UTR Luciferase Stable Cell Line |
TU015939 |
ABM |
1.0 ml |
EUR 1521 |
Nr2c1 3'UTR Luciferase Stable Cell Line |
TU114293 |
ABM |
1.0 ml |
Ask for price |
NR2C1 3'UTR GFP Stable Cell Line |
TU065939 |
ABM |
1.0 ml |
EUR 1521 |
Nr2c1 3'UTR GFP Stable Cell Line |
TU264163 |
ABM |
1.0 ml |
Ask for price |
Nr2c1 3'UTR Luciferase Stable Cell Line |
TU214163 |
ABM |
1.0 ml |
Ask for price |
Nuclear Receptor Subfamily 2, Group C, Member 1 (NR2C1) Antibody |
20-abx114195 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
abx122665-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
20-abx142106 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
20-abx006832 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
abx028626-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
abx028626-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
20-abx320065 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
20-abx321546 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nuclear Receptor Subfamily 2 Group C Member 1 (NR2C1) Antibody |
abx235840-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
NR2C1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV666865 |
ABM |
1.0 ug DNA |
EUR 682 |
NR2C1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV666869 |
ABM |
1.0 ug DNA |
EUR 682 |
NR2C1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV666870 |
ABM |
1.0 ug DNA |
EUR 682 |
VEGF Rabbit Polyclonal Antibody |
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
Nrf2 Rabbit Polyclonal Antibody |
ES8568-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4a Rabbit Polyclonal Antibody |
ES8569-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4b Rabbit Polyclonal Antibody |
ES8570-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG4c Rabbit Polyclonal Antibody |
ES8571-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG5 Rabbit Polyclonal Antibody |
ES8572-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG7 Rabbit Polyclonal Antibody |
ES8573-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8574-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG13 Rabbit Polyclonal Antibody |
ES8575-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATG14L Rabbit Polyclonal Antibody |
ES8576-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8578-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NBR1 Rabbit Polyclonal Antibody |
ES8579-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NR2C1 Rabbit Polyclonal Antibody