OASL Rabbit Polyclonal Antibody
To Order: garrett@bioworldantibodies.com
 OASL Polyclonal Antibody |
|
ABP59631-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human OASL protein at amino acid sequence of 1-50
- Applications tips:
|
|
Description: A polyclonal antibody for detection of OASL from Human. This OASL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OASL protein at amino acid sequence of 1-50 |
OASL Polyclonal Antibody |
|
ABP59631-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human OASL protein at amino acid sequence of 1-50
- Applications tips:
|
|
Description: A polyclonal antibody for detection of OASL from Human. This OASL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OASL protein at amino acid sequence of 1-50 |
OASL Polyclonal Antibody |
|
ES8870-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against OASL from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
OASL Polyclonal Antibody |
|
ES8870-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against OASL from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 OASL Rabbit pAb |
|
A10527-100ul |
Abclonal |
100 ul |
EUR 308 |
OASL Rabbit pAb |
|
A10527-200ul |
Abclonal |
200 ul |
EUR 459 |
OASL Rabbit pAb |
|
A10527-20ul |
Abclonal |
20 ul |
EUR 183 |
OASL Rabbit pAb |
|
A10527-50ul |
Abclonal |
50 ul |
EUR 223 |
OASL Rabbit pAb |
|
A2775-100ul |
Abclonal |
100 ul |
EUR 308 |
OASL Rabbit pAb |
|
A2775-200ul |
Abclonal |
200 ul |
EUR 459 |
OASL Rabbit pAb |
|
A2775-20ul |
Abclonal |
20 ul |
Ask for price |
OASL Rabbit pAb |
|
A2775-50ul |
Abclonal |
50 ul |
EUR 223 |
 OASL Polyclonal Conjugated Antibody |
|
C46919 |
SAB |
100ul |
EUR 397 |
 OASL Antibody |
|
35849-100ul |
SAB |
100ul |
EUR 252 |
OASL Antibody |
|
1-CSB-PA661512 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
|
Description: A polyclonal antibody against OASL. Recognizes OASL from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000 |
OASL Antibody |
|
1-CSB-PA925792 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against OASL. Recognizes OASL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
OASL Antibody |
|
1-CSB-PA953473 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against OASL. Recognizes OASL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100 |
 OASL antibody |
|
70R-5888 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal OASL antibody raised against the middle region of OASL |
OASL antibody |
|
70R-5891 |
Fitzgerald |
50 ug |
EUR 467 |
|
Description: Rabbit polyclonal OASL antibody raised against the N terminal of OASL |
 ELISA Kit) Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit |
|
DLR-OASL-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) in samples from serum, plasma, cell lysates or other biological fluids. |
Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit |
|
DLR-OASL-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) in samples from serum, plasma, cell lysates or other biological fluids. |
Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit |
|
RDR-OASL-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit |
|
RDR-OASL-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit |
|
RD-OASL-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit |
|
RD-OASL-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
) Polyclonal OASL Antibody (N-Terminus) |
|
APR03344G |
Leading Biology |
0.05mg |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OASL (N-Terminus). This antibody is tested and proven to work in the following applications: |
) Polyclonal OASL Antibody (C-term) |
|
APR05723G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OASL (C-term). This antibody is tested and proven to work in the following applications: |
 OASL Conjugated Antibody |
|
C35849 |
SAB |
100ul |
EUR 397 |
 Anti-OASL antibody |
|
STJ99343 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Rabbit polyclonal to OASL. |
 OASL siRNA |
|
20-abx926732 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
OASL siRNA |
|
20-abx926733 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 polyclonal antibody) 2'-5'-oligoadenylate synthetase-like (OASL) polyclonal antibody |
|
ABP-PAB-10922 |
Allele Biotech |
100 ug |
Ask for price |
- Product line: Miscellaneous
- Brand:
|
 OASL Blocking Peptide |
|
33R-1866 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OASL antibody, catalog no. 70R-5891 |
OASL Blocking Peptide |
|
33R-7944 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OASL antibody, catalog no. 70R-5888 |
 OASL cloning plasmid |
|
CSB-CL614897HU-10ug |
Cusabio |
10ug |
EUR 376 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1545
- Sequence: atggcactgatgcaggaactgtatagcacaccagcctccaggctggactccttcgtggctcagtggctgcagccccaccgggagtggaaggaagaggtgctagacgctgtgcggaccgtggaggagtttctgaggcaggagcatttccaggggaagcgtgggctggaccaggatg
- Show more
|
|
Description: A cloning plasmid for the OASL gene. |
 Rat OASL shRNA Plasmid |
|
20-abx989276 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human OASL shRNA Plasmid |
|
20-abx955677 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) OASL Recombinant Protein (Human) |
|
RP041806 |
ABM |
100 ug |
Ask for price |
) OASL Recombinant Protein (Rat) |
|
RP214976 |
ABM |
100 ug |
Ask for price |
 Polyclonal Antibody (Human)) 2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human) |
|
4-PAF691Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OASL (Ala2~Trp244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL) |
 Polyclonal Antibody (Human), APC) 2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), APC |
|
4-PAF691Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OASL (Ala2~Trp244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) 2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), Biotinylated |
|
4-PAF691Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OASL (Ala2~Trp244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) 2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), Cy3 |
|
4-PAF691Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OASL (Ala2~Trp244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) 2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), FITC |
|
4-PAF691Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OASL (Ala2~Trp244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) 2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), HRP |
|
4-PAF691Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OASL (Ala2~Trp244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) 2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), PE |
|
4-PAF691Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OASL (Ala2~Trp244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with PE. |
 Antibody) 2',5'-Oligoadenylate Synthetase Like (OASL) Antibody |
|
20-abx006291 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 314.00
|
|
- Shipped within 5-10 working days.
|
 Antibody) 2,5-Oligoadenylate Synthetase Like Protein (OASL) Antibody |
|
20-abx210547 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
2',5'-Oligoadenylate Synthetase Like (OASL) Antibody |
|
20-abx126989 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
2',5'-Oligoadenylate Synthetase Like (OASL) Antibody |
|
abx146026-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
2,5-Oligoadenylate Synthetase Like Protein (OASL) Antibody |
|
20-abx171013 |
Abbexa |
|
|
|
|
2',5'-Oligoadenylate Synthetase Like (OASL) Antibody |
|
abx032744-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
2',5'-Oligoadenylate Synthetase Like (OASL) Antibody |
|
abx032744-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
2,5-Oligoadenylate Synthetase Like Protein (OASL) Antibody |
|
20-abx339473 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
2,5-Oligoadenylate Synthetase Like Protein (OASL) Antibody |
|
20-abx324997 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 (pORF)) Oasl ORF Vector (Rat) (pORF) |
|
ORF071660 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) OASL ORF Vector (Human) (pORF) |
|
ORF013936 |
ABM |
1.0 ug DNA |
EUR 95 |
 (OKCD00204)) OASL ELISA Kit (Human) (OKCD00204) |
|
OKCD00204 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
|
Description: Description of target: Does not have 2'-5'-OAS activity, but can bind double-stranded RNA. Displays antiviral activity against encephalomyocarditis virus (EMCV) and hepatitis C virus (HCV) via an alternative antiviral pathway independent of RNase L.3 Publications
<p>Manually curated information for which there is published experimental evidence.</p>
<p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Molecular cloning and characterization of two related and interferon-induced 56-kDa and 30-kDa proteins highly similar to 2'-5' oligoadenylate synthetase."_x005F_x005F_x000D_Rebouillat D., Marie I., Hovanessian A.G._x005F_x005F_x000D_Eur. J. Biochem. 257:319-330(1998) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORMS P56 AND P30), FUNCTION, SUBCELLULAR LOCATION.Ref.10"The p59 oligoadenylate synthetase-like protein possesses antiviral activity that requires the C-terminal ubiquitin-like domain."_x005F_x005F_x000D_Marques J., Anwar J., Eskildsen-Larsen S., Rebouillat D., Paludan S.R., Sen G., Williams B.R., Hartmann R._x005F_x005F_x000D_J. Gen. Virol. 89:2767-2772(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.13"2',5'-Oligoadenylate synthetase-like gene highly induced by hepatitis C virus infection in human liver is inhibitory to viral replication in vitro."_x005F_x005F_x000D_Ishibashi M., Wakita T., Esumi M._x005F_x005F_x000D_Biochem. Biophys. Res. Commun. 392:397-402(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INDUCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.8 pg/mL |
 Polyclonal Antibody (Human), APC-Cy7) 2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAF691Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: OASL (Ala2~Trp244)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with APC-Cy7. |
 Antibody) 2',5'-Oligoadenylate Synthetase Like Protein (OASL) Antibody |
|
20-abx129161 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
) Oasl sgRNA CRISPR Lentivector set (Rat) |
|
K6118001 |
ABM |
3 x 1.0 ug |
EUR 339 |
) OASL sgRNA CRISPR Lentivector set (Human) |
|
K1473301 |
ABM |
3 x 1.0 ug |
EUR 339 |
 (Target 1)) Oasl sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6118002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Oasl sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6118003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Oasl sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6118004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) OASL sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1473302 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) OASL sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1473303 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) OASL sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1473304 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) OASL Protein Vector (Rat) (pPB-C-His) |
|
PV286638 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) OASL Protein Vector (Rat) (pPB-N-His) |
|
PV286639 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) OASL Protein Vector (Rat) (pPM-C-HA) |
|
PV286640 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) OASL Protein Vector (Rat) (pPM-C-His) |
|
PV286641 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) OASL Protein Vector (Human) (pPB-C-His) |
|
PV055741 |
ABM |
500 ng |
EUR 481 |
 (pPB-N-His)) OASL Protein Vector (Human) (pPB-N-His) |
|
PV055742 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-HA)) OASL Protein Vector (Human) (pPM-C-HA) |
|
PV055743 |
ABM |
500 ng |
EUR 481 |
 (pPM-C-His)) OASL Protein Vector (Human) (pPM-C-His) |
|
PV055744 |
ABM |
500 ng |
EUR 481 |
 OASL 3'UTR GFP Stable Cell Line |
|
TU066159 |
ABM |
1.0 ml |
EUR 1394 |
 OASL 3'UTR Luciferase Stable Cell Line |
|
TU016159 |
ABM |
1.0 ml |
EUR 1394 |
) Recombinant 2',5'-Oligoadenylate Synthetase Like Protein (OASL) |
|
4-RPF691Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q15646
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.6kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Human 2',5'-Oligoadenylate Synthetase Like Protein expressed in: E.coli |
 GAPDH Rabbit Polyclonal Antibody |
|
37985-100ul |
SAB |
100ul |
EUR 252 |
GAPDH Rabbit Polyclonal Antibody |
|
37985-50ul |
SAB |
50ul |
EUR 187 |
 EFHD1 Rabbit Polyclonal Antibody |
|
38001-100ul |
SAB |
100ul |
EUR 252 |
EFHD1 Rabbit Polyclonal Antibody |
|
38001-50ul |
SAB |
50ul |
EUR 187 |
 Alliinase Rabbit Polyclonal Antibody |
|
38042-100ul |
SAB |
100ul |
EUR 252 |
Alliinase Rabbit Polyclonal Antibody |
|
38042-50ul |
SAB |
50ul |
EUR 187 |
 ECFP Rabbit Polyclonal Antibody |
|
38077-100ul |
SAB |
100ul |
EUR 252 |
ECFP Rabbit Polyclonal Antibody |
|
38077-50ul |
SAB |
50ul |
EUR 187 |
 EYFP Rabbit Polyclonal Antibody |
|
38078-100ul |
SAB |
100ul |
EUR 252 |
EYFP Rabbit Polyclonal Antibody |
|
38078-50ul |
SAB |
50ul |
EUR 187 |
 mOrange Rabbit Polyclonal Antibody |
|
38079-100ul |
SAB |
100ul |
EUR 252 |
mOrange Rabbit Polyclonal Antibody |
|
38079-50ul |
SAB |
50ul |
EUR 187 |
 mStrawberry Rabbit Polyclonal Antibody |
|
38083-100ul |
SAB |
100ul |
EUR 252 |
mStrawberry Rabbit Polyclonal Antibody |
|
38083-50ul |
SAB |
50ul |
EUR 187 |
 AmCyan Rabbit Polyclonal Antibody |
|
38086-100ul |
SAB |
100ul |
EUR 252 |
AmCyan Rabbit Polyclonal Antibody |
|
38086-50ul |
SAB |
50ul |
EUR 187 |
 EBFP Rabbit Polyclonal Antibody |
|
38087-100ul |
SAB |
100ul |
EUR 252 |
EBFP Rabbit Polyclonal Antibody |
|
38087-50ul |
SAB |
50ul |
EUR 187 |
 Vimentin Rabbit Polyclonal Antibody |
|
38104-100ul |
SAB |
100ul |
EUR 252 |
Vimentin Rabbit Polyclonal Antibody |
|
38104-50ul |
SAB |
50ul |
EUR 187 |
 LDHD Rabbit Polyclonal Antibody |
|
38105-100ul |
SAB |
100ul |
EUR 252 |
LDHD Rabbit Polyclonal Antibody |
|
38105-50ul |
SAB |
50ul |
EUR 187 |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-005ml |
Abbkine |
0.05ml |
EUR 147 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml |
Abbkine |
0.2ml |
EUR 332 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
GAPDH Rabbit Polyclonal Antibody |
|
A01021-02ml5 |
Abbkine |
0.2ml×5 |
EUR 920 |
- Immunogen information: Recombinant Protein
- Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
- Show more
|
|
Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein |
 Rabbit Hemoglobin Polyclonal Antibody |
|
A53073 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 Met Rabbit Polyclonal Antibody |
|
ABP57458-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
Met Rabbit Polyclonal Antibody |
|
ABP57458-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Met of MET
- Applications tips:
|
|
Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET |
 VEGF Rabbit Polyclonal Antibody |
|
ABP57460-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
VEGF Rabbit Polyclonal Antibody |
|
ABP57460-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of VEGF of VEGFA
- Applications tips:
|
|
Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA |
 CD10 Rabbit Polyclonal Antibody |
|
ABP57461-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
CD10 Rabbit Polyclonal Antibody |
|
ABP57461-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of CD10 of MME
- Applications tips:
|
|
Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME |
 NM23A Rabbit Polyclonal Antibody |
|
ABP57462-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
NM23A Rabbit Polyclonal Antibody |
|
ABP57462-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of NM23A of NME1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1 |
 ATM Rabbit Polyclonal Antibody |
|
ABP57463-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57463-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
ATM Rabbit Polyclonal Antibody |
|
ABP57464-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of ATM of ATM
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM |
 HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
HSC70 Rabbit Polyclonal Antibody |
|
ABP57565-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8) |
 HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
HSP40 Rabbit Polyclonal Antibody |
|
ABP57566-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP40
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40 |
 HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
HSP90Alpha Rabbit Polyclonal Antibody |
|
ABP57567-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Recombinant Protein of HSP90?
- Applications tips:
|
|
Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90? |
 JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
JAK1 Rabbit Polyclonal Antibody |
|
ABP57569-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Recombinant Protein of JAK1
- Applications tips:
|
|
Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1 |
OASL Rabbit Polyclonal Antibody
