OASL Rabbit Polyclonal Antibody

OASL Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

OASL Polyclonal Antibody

ABP59631-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human OASL protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of OASL from Human. This OASL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OASL protein at amino acid sequence of 1-50

OASL Polyclonal Antibody

ABP59631-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human OASL protein at amino acid sequence of 1-50
  • Applications tips:
Description: A polyclonal antibody for detection of OASL from Human. This OASL antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OASL protein at amino acid sequence of 1-50

OASL Polyclonal Antibody

ES8870-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against OASL from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

OASL Polyclonal Antibody

ES8870-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against OASL from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

OASL Rabbit pAb

A10527-100ul 100 ul
EUR 308

OASL Rabbit pAb

A10527-200ul 200 ul
EUR 459

OASL Rabbit pAb

A10527-20ul 20 ul
EUR 183

OASL Rabbit pAb

A10527-50ul 50 ul
EUR 223

OASL Rabbit pAb

A2775-100ul 100 ul
EUR 308

OASL Rabbit pAb

A2775-200ul 200 ul
EUR 459

OASL Rabbit pAb

A2775-20ul 20 ul Ask for price

OASL Rabbit pAb

A2775-50ul 50 ul
EUR 223

OASL Polyclonal Conjugated Antibody

C46919 100ul
EUR 397

OASL Antibody

35849-100ul 100ul
EUR 252

OASL Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against OASL. Recognizes OASL from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-2000, ELISA:1:10000-20000

OASL Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OASL. Recognizes OASL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

OASL Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OASL. Recognizes OASL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

OASL antibody

70R-5888 50 ug
EUR 467
Description: Rabbit polyclonal OASL antibody raised against the middle region of OASL

OASL antibody

70R-5891 50 ug
EUR 467
Description: Rabbit polyclonal OASL antibody raised against the N terminal of OASL

Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit

EUR 517
  • Should the Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) in samples from serum, plasma, cell lysates or other biological fluids.

Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit

EUR 673
  • Should the Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) in samples from serum, plasma, cell lysates or other biological fluids.

Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit

RDR-OASL-Hu-48Tests 48 Tests
EUR 544

Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit

RDR-OASL-Hu-96Tests 96 Tests
EUR 756

Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit

RD-OASL-Hu-48Tests 48 Tests
EUR 521

Human 2',5'-Oligoadenylate Synthetase Like Protein (OASL) ELISA Kit

RD-OASL-Hu-96Tests 96 Tests
EUR 723

Polyclonal OASL Antibody (N-Terminus)

APR03344G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OASL (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal OASL Antibody (C-term)

APR05723G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OASL (C-term). This antibody is tested and proven to work in the following applications:

OASL Conjugated Antibody

C35849 100ul
EUR 397

Anti-OASL antibody

STJ24856 100 µl
EUR 277

Anti-OASL antibody

STJ112547 100 µl
EUR 277

Anti-OASL antibody

STJ99343 200 µl
EUR 197
Description: Rabbit polyclonal to OASL.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

2'-5'-oligoadenylate synthetase-like (OASL) polyclonal antibody

ABP-PAB-10922 100 ug Ask for price
    • Product line: Miscellaneous
    • Brand:

OASL Blocking Peptide

33R-1866 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OASL antibody, catalog no. 70R-5891

OASL Blocking Peptide

33R-7944 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OASL antibody, catalog no. 70R-5888

OASL cloning plasmid

CSB-CL614897HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggcactgatgcaggaactgtatagcacaccagcctccaggctggactccttcgtggctcagtggctgcagccccaccgggagtggaaggaagaggtgctagacgctgtgcggaccgtggaggagtttctgaggcaggagcatttccaggggaagcgtgggctggaccaggatg
  • Show more
Description: A cloning plasmid for the OASL gene.

Rat OASL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OASL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-35450h 96 Tests
EUR 824

OASL Recombinant Protein (Human)

RP041806 100 ug Ask for price

OASL Recombinant Protein (Rat)

RP214976 100 ug Ask for price

2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OASL (Ala2~Trp244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL)

2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OASL (Ala2~Trp244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with APC.

2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OASL (Ala2~Trp244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with Biotin.

2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OASL (Ala2~Trp244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with Cy3.

2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OASL (Ala2~Trp244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with FITC.

2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OASL (Ala2~Trp244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with HRP.

2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OASL (Ala2~Trp244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with PE.

2',5'-Oligoadenylate Synthetase Like (OASL) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

2,5-Oligoadenylate Synthetase Like Protein (OASL) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

2',5'-Oligoadenylate Synthetase Like (OASL) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

2',5'-Oligoadenylate Synthetase Like (OASL) Antibody

abx146026-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

2,5-Oligoadenylate Synthetase Like Protein (OASL) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

2',5'-Oligoadenylate Synthetase Like (OASL) Antibody

abx032744-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

2',5'-Oligoadenylate Synthetase Like (OASL) Antibody

abx032744-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

2,5-Oligoadenylate Synthetase Like Protein (OASL) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

2,5-Oligoadenylate Synthetase Like Protein (OASL) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Oasl ORF Vector (Rat) (pORF)

ORF071660 1.0 ug DNA
EUR 506

OASL ORF Vector (Human) (pORF)

ORF013936 1.0 ug DNA
EUR 95

OASL ELISA Kit (Human) (OKCD00204)

OKCD00204 96 Wells
EUR 831
Description: Description of target: Does not have 2'-5'-OAS activity, but can bind double-stranded RNA. Displays antiviral activity against encephalomyocarditis virus (EMCV) and hepatitis C virus (HCV) via an alternative antiviral pathway independent of RNase L.3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Molecular cloning and characterization of two related and interferon-induced 56-kDa and 30-kDa proteins highly similar to 2'-5' oligoadenylate synthetase."_x005F_x005F_x000D_Rebouillat D., Marie I., Hovanessian A.G._x005F_x005F_x000D_Eur. J. Biochem. 257:319-330(1998) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORMS P56 AND P30), FUNCTION, SUBCELLULAR LOCATION.Ref.10"The p59 oligoadenylate synthetase-like protein possesses antiviral activity that requires the C-terminal ubiquitin-like domain."_x005F_x005F_x000D_Marques J., Anwar J., Eskildsen-Larsen S., Rebouillat D., Paludan S.R., Sen G., Williams B.R., Hartmann R._x005F_x005F_x000D_J. Gen. Virol. 89:2767-2772(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.13"2',5'-Oligoadenylate synthetase-like gene highly induced by hepatitis C virus infection in human liver is inhibitory to viral replication in vitro."_x005F_x005F_x000D_Ishibashi M., Wakita T., Esumi M._x005F_x005F_x000D_Biochem. Biophys. Res. Commun. 392:397-402(2010) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INDUCTION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.8 pg/mL

2', 5'-Oligoadenylate Synthetase Like Protein (OASL) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OASL (Ala2~Trp244)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human 2', 5'-Oligoadenylate Synthetase Like Protein (OASL). This antibody is labeled with APC-Cy7.

2',5'-Oligoadenylate Synthetase Like Protein (OASL) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Oasl sgRNA CRISPR Lentivector set (Rat)

K6118001 3 x 1.0 ug
EUR 339

OASL sgRNA CRISPR Lentivector set (Human)

K1473301 3 x 1.0 ug
EUR 339

Oasl sgRNA CRISPR Lentivector (Rat) (Target 1)

K6118002 1.0 ug DNA
EUR 154

Oasl sgRNA CRISPR Lentivector (Rat) (Target 2)

K6118003 1.0 ug DNA
EUR 154

Oasl sgRNA CRISPR Lentivector (Rat) (Target 3)

K6118004 1.0 ug DNA
EUR 154

OASL sgRNA CRISPR Lentivector (Human) (Target 1)

K1473302 1.0 ug DNA
EUR 154

OASL sgRNA CRISPR Lentivector (Human) (Target 2)

K1473303 1.0 ug DNA
EUR 154

OASL sgRNA CRISPR Lentivector (Human) (Target 3)

K1473304 1.0 ug DNA
EUR 154

OASL Protein Vector (Rat) (pPB-C-His)

PV286638 500 ng
EUR 603

OASL Protein Vector (Rat) (pPB-N-His)

PV286639 500 ng
EUR 603

OASL Protein Vector (Rat) (pPM-C-HA)

PV286640 500 ng
EUR 603

OASL Protein Vector (Rat) (pPM-C-His)

PV286641 500 ng
EUR 603

OASL Protein Vector (Human) (pPB-C-His)

PV055741 500 ng
EUR 481

OASL Protein Vector (Human) (pPB-N-His)

PV055742 500 ng
EUR 481

OASL Protein Vector (Human) (pPM-C-HA)

PV055743 500 ng
EUR 481

OASL Protein Vector (Human) (pPM-C-His)

PV055744 500 ng
EUR 481

OASL 3'UTR GFP Stable Cell Line

TU066159 1.0 ml
EUR 1394

OASL 3'UTR Luciferase Stable Cell Line

TU016159 1.0 ml
EUR 1394

Recombinant 2',5'-Oligoadenylate Synthetase Like Protein (OASL)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15646
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human 2',5'-Oligoadenylate Synthetase Like Protein expressed in: E.coli

GAPDH Rabbit Polyclonal Antibody

37985-100ul 100ul
EUR 252

GAPDH Rabbit Polyclonal Antibody

37985-50ul 50ul
EUR 187

EFHD1 Rabbit Polyclonal Antibody

38001-100ul 100ul
EUR 252

EFHD1 Rabbit Polyclonal Antibody

38001-50ul 50ul
EUR 187

Alliinase Rabbit Polyclonal Antibody

38042-100ul 100ul
EUR 252

Alliinase Rabbit Polyclonal Antibody

38042-50ul 50ul
EUR 187

ECFP Rabbit Polyclonal Antibody

38077-100ul 100ul
EUR 252

ECFP Rabbit Polyclonal Antibody

38077-50ul 50ul
EUR 187

EYFP Rabbit Polyclonal Antibody

38078-100ul 100ul
EUR 252

EYFP Rabbit Polyclonal Antibody

38078-50ul 50ul
EUR 187

mOrange Rabbit Polyclonal Antibody

38079-100ul 100ul
EUR 252

mOrange Rabbit Polyclonal Antibody

38079-50ul 50ul
EUR 187

mStrawberry Rabbit Polyclonal Antibody

38083-100ul 100ul
EUR 252

mStrawberry Rabbit Polyclonal Antibody

38083-50ul 50ul
EUR 187

OASL Rabbit Polyclonal Antibody

Back To Top