PAK6 Rabbit Polyclonal Antibody

PAK6 Rabbit Polyclonal Antibody

To Order: garrett@bioworldantibodies.com

Polyclonal PAK6 Antibody
APR17745G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK6 . This antibody is tested and proven to work in the following applications:

PAK6 Polyclonal Antibody
ABP59817-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAK6 from Human, Mouse. This PAK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180

PAK6 Polyclonal Antibody
ABP59817-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAK6 from Human, Mouse. This PAK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180

PAK6 Polyclonal Antibody
ABP59817-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180
  • Applications tips:
Description: A polyclonal antibody for detection of PAK6 from Human, Mouse. This PAK6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PAK6 protein at amino acid sequence of 100-180

PAK6 Polyclonal Antibody
ES8980-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against PAK6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PAK6 Polyclonal Antibody
ES8980-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against PAK6 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PAK6 Rabbit pAb
A7821-100ul 100 ul
EUR 308

PAK6 Rabbit pAb
A7821-200ul 200 ul
EUR 459

PAK6 Rabbit pAb
A7821-20ul 20 ul
EUR 183

PAK6 Rabbit pAb
A7821-50ul 50 ul
EUR 223

PAK6 Rabbit pAb
A4871-100ul 100 ul
EUR 308

PAK6 Rabbit pAb
A4871-200ul 200 ul
EUR 459

PAK6 Rabbit pAb
A4871-20ul 20 ul Ask for price

PAK6 Rabbit pAb
A4871-50ul 50 ul Ask for price

Polyclonal PAK6 Antibody (Center)
APR17746G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PAK6 (Center). This antibody is tested and proven to work in the following applications:

PAK6 Antibody
24181-100ul 100ul
EUR 390

PAK6 antibody
20R-1757 100 ug
EUR 673
Description: Rabbit polyclonal PAK6 antibody

PAK6 antibody
20R-PR073 50 ug
EUR 656
Description: Rabbit polyclonal PAK6 antibody

PAK6 antibody
70R-19099 50 ul
EUR 435
Description: Rabbit polyclonal PAK6 antibody

PAK6 antibody
70R-12193 100 ug
EUR 403
Description: Rabbit polyclonal PAK6 antibody

PAK6 antibody
70R-14266 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal PAK6 antibody

PAK6 Antibody
35865-100ul 100ul
EUR 252

PAK6 Antibody
3927-100
EUR 316

PAK6 Antibody
3927-30T
EUR 146

PAK6 Antibody
1-CSB-PA927575
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PAK6 Antibody
1-CSB-PA971648
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:100

PAK6 Antibody
1-CSB-PA865108ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PAK6 Antibody
DF10138 200ul
EUR 304
Description: PAK6 Antibody detects endogenous levels of total PAK6.

PAK6 Antibody
1-CSB-PA017409GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PAK6. Recognizes PAK6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PAK6 antibody
70R-51044 100 ul
EUR 244
Description: Purified Polyclonal PAK6 antibody

PAK6 Antibody
ABD10138 100 ug
EUR 438

PAK7/PAK6 Antibody
1-CSB-PA040042
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PAK7/PAK6. Recognizes PAK7/PAK6 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

PAK6 (pS165) Antibody
abx217623-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

PAK6 Conjugated Antibody
C35865 100ul
EUR 397

PAK7 / PAK6 Antibody
20-abx325554
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

anti- PAK6 antibody
FNab06124 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: p21 protein (Cdc42/Rac)-activated kinase 6
  • Uniprot ID: Q9NQU5
  • Gene ID: 56924
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against PAK6

Anti-PAK6 Antibody
PA1729 100ug/vial
EUR 334

Anti-PAK6 antibody
PAab06124 100 ug
EUR 355

Anti-PAK6 antibody
STJ110131 100 µl
EUR 277
Description: This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants.

Anti-PAK6 antibody
STJ24891 100 µl
EUR 277
Description: This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants.

Anti-PAK6 antibody
STJ190138 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to PAK6

PAK6 siRNA
20-abx927649
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PAK6 siRNA
20-abx927650
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-PAK6
YF-PA20072 50 ul
EUR 363
Description: Mouse polyclonal to PAK6

anti-PAK6
YF-PA20073 100 ug
EUR 403
Description: Rabbit polyclonal to PAK6

Phospho-PAK6 (Ser165) Antibody
AF8297 200ul
EUR 376
Description: PAK6 (Phospho-Ser165) Antibody detects endogenous levels of PAK6 only when phosphorylated at Ser165.

PAK6 (Phospho- Ser165) Antibody
ABF8297 100 ug
EUR 438

PAK6 Blocking Peptide
33R-10569 50 ug
EUR 349
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK6 antibody, catalog no. 20R-1757

PAK6 Blocking Peptide
33R-11001 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PAK6 antibody, catalog no. 70R-12193

PAK6 Blocking Peptide
3927BP-50
EUR 153

PAK6 Blocking Peptide
DF10138-BP 1mg
EUR 195

PAK6 Blocking Peptide
20-abx063919
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

PAK6 cloning plasmid
CSB-CL865108HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2046
  • Sequence: atgttccgcaagaaaaagaagaaacgccctgagatctcagcgccacagaacttccagcaccgtgtccacacctccttcgaccccaaagaaggcaagtttgtgggcctccccccacaatggcagaacatcctggacacactgcggcgccccaagcccgtggtggacccttcgcgaa
  • Show more
Description: A cloning plasmid for the PAK6 gene.

PAK7 / PAK6 (pS602 / S560) Antibody
20-abx325465
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PAK7 / PAK6 (pS602 / pS560) Antibody
abx333028-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Phospho-PAK7/PAK6 (Ser602/Ser560) Antibody
CSB-PA285604-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PAK7/PAK6 (Ser602/Ser560). Recognizes Phospho-PAK7/PAK6 (Ser602/Ser560) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PAK7/PAK6 (Ser602/Ser560) Antibody
CSB-PA285604-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Antibodie
  • Show more
Description: A polyclonal antibody against Phospho-PAK7/PAK6 (Ser602/Ser560). Recognizes Phospho-PAK7/PAK6 (Ser602/Ser560) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-PAK7/PAK6 (S602/S560) Antibody
1-CSB-PA040041
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-PAK7/PAK6 (S602/S560). Recognizes Phospho-PAK7/PAK6 (S602/S560) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

P21 Activated Kinase 6 (PAK6) Antibody
20-abx007072
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
20-abx008094
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
abx026628-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
abx026628-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
20-abx003695
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
20-abx212643
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
20-abx212829
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
abx038429-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
abx048495-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
abx033771-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
abx033771-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
abx412258-50ug 50 ug
EUR 509
  • Shipped within 1 week.

P21 Activated Kinase 6 (PAK6) Antibody
20-abx320476
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

P21 Activated Kinase 6 (PAK6) Antibody
abx236124-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

PAK6 ELISA KIT|Human
EF001537 96 Tests
EUR 689

Human PAK6 shRNA Plasmid
20-abx961226
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse PAK6 shRNA Plasmid
20-abx980853
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Phospho-PAK6 (Ser165) Blocking Peptide
AF8297-BP 1mg
EUR 195

PAK6 Rabbit Polyclonal Antibody

Back To Top